Subtractive PCR

The subtractive PCR was carried out as described by Nakayama et al. (1996). RNA was extracted from wing buds at stage 20 (AER(+)) and wing buds 24 hr after AER removal (AER(-)), by the acid guanidinium thiocyanate-phenol-chloroform (AGPC) method (Chomczynski and Sacchi, 1987). Poly(A)⁺ RNA was purified from each sample on oligotex-dT 30 super (Takara), and double-stranded cDNAs were synthesized using a cDNA synthesis kit (Pharmacia). cDNAs were the digested with restriction enzyme RsaI (Takara) to produce fragments for subtraction. The digested DNA fragments of AER(+) and the AER(-) were ligated respectively with M13-forward (gtaaaacgacggccagtgag) and M13-reverse (cggaaacagctatgaccatg) adapters. An AER(+) specific library was constructed by subtraction of AER(-) from AER(+), then amplifying by PCR using M13-reverse primer to amplify specifically subtracted AER(+). The amplified fragments were subcloned into pCR-TMII plasmid vector (Invitrogen). Sequences of the clones were determined by the dideoxy chain-termination method using a sequencing kit (Amersham) and auto sequencer (HITACHI).

Databases were searched with the BLAST program (Altschul et al., 1990) using the NCBI network service.

FGF-2 application in the chick wing bud mesoderm

Stage 20 wing buds were dissected and placed in 1% trypsin for 30 min. at 4°C to remove the ectoderm (Aono and Ide, 1988). The denuded mesoderm fragments were kept in F12 medium (Nissui) containing 1% FCS at 37°C.

For FGF-2 application, Affi-Gel beads (200-250 μm diameter; Bio-Rad) were soaked in 2 μ1 of 0.1 μg/ml FGF-2 (R&D systems) for at least 1 hr at room temperature before application. A small slit was made in the denuded mesoderm with a needle and a bead was inserted into it. The operated mesoderm fragments were incubated in the F12 medium containing 1% FCS under conditions as reported previously (Aono and Ide, 1988) for 24 hr, fixed in 4% paraformaldehyde and then examined for gene expression.

In situ hybridization

In situ hybridization was performed using digoxigenin-labeled probes following the procedures of Yokouchi et al. (1991), and whole-mount in situ hybridizations were carried out as described by Yonei et al. (1995).

Expression pattern of cLbp in developing embryo

The spatial expression pattern of cLbp was determined by in situ hybridization. We hybridized adjacent sections with the prospective sense and anti-sense probes for cLbp fragment, SUB44 (Fig. 1a). Control embryos hybridized with a sense probe did not show signals (not shown).

Remarkable expression of cLbp in stage 24 embryos could be observed in branchial arches (maxillary, mandibular, and hyoid arch), dermomyotome, and in the distal margin of limb buds (Fig. 2a). In sections through the otocysts, cLbp was expressed in the mesoderm of the hyoid arch, being especially strong in areas underneath ectoderm (Fig. 2b). Weak expression was also observed in the neural tube and the otocyst. In sections through the trunk, cLbp was strongly expressed in the neural tube, dorsal root ganglia, and nerve roots (Fig. 2c). Neural crest and notochord was negative. The dorsal lateral region of the somite was positive, though the sclerotome was negative at this stage (Fig. 2c). The precursors of the limb musculature (arrowheads in Fig. 3c), which emigrated from the dermomyotome into the limb bud (Chevallier et al., 1977; Williams and Ordahl, 1994), were positive. Mesonephrons also expressed cLbp strongly.

Fig. 2

Analysis of cLbp expression in stage 24 chick embryo, (a) Whole mount views. Arrowheads indicate myotome, (b) Transverse section at the hindbrain level, and (c) at the trunk level, dr, dorsal root ganglia; hb, hindbrain; hy, hyoid arch; ma, maxillary; md, mandibular; my, myotome; n, neural tube; nt, notochord; ot, otocyst; pr, pharynx. Bars= 1mm for (a); 100 μm for (b) and (c).

Fig. 3

cLbp expression in developing wing bud (see text). Adjacent section at the wing bud level (a), and trunk level (b) of a stage 18 embryo. Arrow indicates the prospective AER. dm, dermomyotome; sc, sclerotome; mn, mesonephros. (c) Transverse section from stage 20 embryo through the wing region. Arrow indicates AER. Arrowheads indicate the precursors of the limb musculature. mn, mesonephros. D, dorsal; V, ventral, (d) Horizontal section of a wing bud in stage 20 embryo. This section is at a slightly dorsal level and so does not contain the AER. A, anterior; P, posterior; Di, distal; Pr, proximal, (e) Transverse section of a wing bud in stage 24 embryo, Arrow indicates AER. (f) Parasagittal section at the proximal region of a stage 24 wing bud. Arrowheads indicate skeletal muscles. Bars = 300 μm for (a) and (b); 500 μm for (c)-(f).

The expression patterns of cLbp in various tissues of stage 16-29 embryos are summarized in Table 1. The expression in dermatome decreased by stage 25. The differentiating sclerotome was positive until stage 18 (cf. Fig. 3a, b). The other tissues showed the same expression pattern throughout stages 16 to 29.

Table 1

Summary of cLbp expression*

Expression pattern of cLbp in the developing limb bud

The prospective wing mesoderm of stage 16 embryos did not express cLBP mRNA (not shown). The expression was first detected at stage 18 in the whole mesoderm of the limb bud (Fig. 3a), but not in the flank region (Fig. 3b). The prospective AER was positive (arrow in Fig. 3a), but non-ridge ectoderm was negative. In stage 20 limb buds, cLBP mRNA was transcribed broadly in the mesoderm of the distal region, being most abundant in the cells underneath the dorsal ectoderm (Fig. 3c). The AER, especially cells at the epidermal-mesodermal interface, was positive (arrow in Fig. 3c), whereas non-ridge ectoderm was negative. Hybridization to a horizontal section (Fig. 3d) showed no difference in expression along the anteroposterior axis of limb bud. The expression was gradually restricted to the distal margin during limb development. At stage 24, expression remained in the region of the distal mesoderm underneath the ectoderm, but disappeared in the proximal mesoderm (Fig. 5e). In the proximal region the expression was observed the skeletal muscle, but not in the developing skeletal elements including the perichondrium (Fig. 5f). By stage 29, cLbp expression had decreased (Table 1).

AER-dependent expression of cLbp

The cLBP mRNA significantly decreased in the AER-free limb bud as compared with normal controls, suggesting a possibility that cLbp transcription could be maintained by the AER. Msx1 is expressed in the AER and in the mesoderm underneath it (Yokouchi et al., 1991), and expression is controlled by signals emanating from the AER (Ros et al., 1992). Therefore, we compared cLbp and Msx1 expression patterns by whole mount in situ hybridization.

cLbp expression was stronger in the marginal zone of the limb bud, but disappeared in the flank region (Fig. 4a). The expression pattern was similar to that of Msx1 in early stage limb buds (Fig. 4b). At stage 25, expression was observed in areas distal to the autopodium, and also remained in the posterior marginal zone (Fig. 4c). These patterns were broader than the Msx1 expression which was restricted to the distal margin and the interdigits (Fig. 4d). Both cLbp (5 cases; Fig. 4e) and Msx1 (3 cases; Fig. 4f) expressions were dramatically reduced in the limb bud 24 hr after surgical removal of the AER at stage 20. This result supports data from Northern hybridization (cf. Fig. 1b). However, the expression of cLbp could still be observed 12 hr after AER removal (not shown), whereas the expression of Msx1 was undetectable in the distal mesoderm by 6 hr after the operation (Ros et al., 1992).

Fig. 4

Comparison of cLbp and Msx1 expression in limb buds. During early stages of limb development cLbp is expressed in the peripheral zone, overlapping Msx1. Shown are whole-mount in situ hybridizations of stage 22 limb buds probed for cLbp (a), Msx1 (b). At stage 25 cLbp expression (c) is broader than Msx1 expression which is restricted to the distal margin and interdigit regions (d). Both cLbp (e) and Msx1 (f) expression were dramatically reduced in the limb bud 24 hr after AER removal at stage 20. Bars = 500 μm.

Fig. 5

Effect of FGF-2 on cLbp expression in chick limb mesodermal cells. (a) Bead (asterisk) presoaked in PBS containing FGF-2 (0.1 jig/ml) was implanted in the limb mesoderm from which ectoderm was removed in advance. (b) Control case with PBS-loaded bead (asterisk). Bars = 100 μm.

FGF-2 has been shown to mimic the functions of the AER (Riley et al., 1993; Fallon et al., 1994). To determine whether FGF-2 is abie to induce cLbp expression in the mesoderm of stage 20 limb bud, a heparin bead soaked in FGF-2 (0.1 μg/ml) was applied to the mesodermal mass lacking an AER (7 of 10 cases). After 24 hr, expression was induced in the mesoderm surrounding the FGF-2 bead (Fig. 5a), whereas little signal was detected in control fragments (8 cases; Fig. 5b).

Characteristics and possible role of cLBP in developing limb bud

The 67 kDa laminin binding protein (67 kDa LBP) was originally isolated from the extracts of mammalian cells by affinity chromatography on laminin-Sepharose columns (Wewer et al., 1986). This protein binds the peptide sequence YIGSR, found in the p1 chain of laminin, with higher affinity than the integrins (Graf et al., 1987; Bushkin-Harav et al., 1995; Landowski et al., 1995a), and might play a role in cell attachment, spreading, and polarization (Hand et al., 1985; Wewer et al., 1987; Cixe et al., 1991; Salas et al., 1992). A partial cDNA clone for the human 67 kDa LBP was originally selected from an expression library by screening with a monoclonal antibody raised against human laminin (Wewer et al., 1986). Subsequently, full-length cDNA clones were obtained, from various mammals, by investigators specifically interested in laminin binding proteins (Rao et al., 1989; Grosso et al., 1991), as well as groups studying gene expression in transformed cells (Yow et al., 1988; Satoh et al., 1992a, b; Kondoh et al., 1992), translational control in mouse cells (Chitpatima et al., 1988), and development of the embryonic eye (Rabacchi et al., 1990). All the cDNAs obtained encode proteins of estimated molecular weight between 32-34 kDa, which corresponds to the 32 kDa precursor of the 67 kDa LBP in human cells (Landowski et al., 1995b), and the amino acid sequences are highly conserved. These proteins lack the signal sequences or simple hydrophobic domains that would be expected in a typical trans-membrane protein (Grosso et al., 1991). cLBP had no distinct N-terminal signal peptide sequence following the putative initiation site (GenBank X94368). However, Landowski et al. (1995a) shows the expression of the 67 kDa LBP on the cell surface using a homotypic overexpression system. It appears to form a homodimer of 32 kDa subunits (Landowski et al., 1995b), associates with membranes and interacts with elements of the cytoskeleton (Brown et al., 1983; Massia et al., 1993; Keppel and Schaller, 1991). These observations suggest that LBP function may be dependent on posttranslational modifications responsible for surface localization and laminin-binding characteristics (Landowski et al., 1995a).

In chick limb bud, laminin is present in all regions of the subectodermal basement membrane as a clearly defined line and also in the distal mesoderm (Critchlow and Hinchliffe, 1994). We showed that cLbp was localized in the AER and the distal mesoderm underneath it (Fig. 3e), whereas (31 integrin, which is a subunit for laminin receptors (von der Mark et al., 1991; Sonnenberg et al., 1993; Thorsteinsdottir et al., 1995), localized along the entire epidermal-mesodermal interface (Critchlow and Hinchliffe, 1994), suggesting that cLBP might have different roles from the integrin receptor in epidermal-mesodermal interaction. Salas et al. (1992) shows that the 67 kDa LBP is involved in the acquisition of apical polarity of MDCK cells. These results indicate that cLbp might transduce an ECM-signal to the cell responsible for the organization of the apical region in the limb bud. In addition there is evidence that the ECM also plays a role in establishing morphological differences between AER and non-ridge epithelia in the limb bud (Tomasek and Brier, 1986). cLBP may therefore also participate in maintaining the special AER structure.

The expression of cLbp in the muscle precursors (cf. Fig. 3c) and muscle masses (cf. Fig. 3f) might be of significance in relation to the formation of the muscle masses in the limb bud. Laminin is concentrated in the muscle masses in the limb bud (Solursh and Jensen, 1988; Critchlow and Hinchliffe, 1994). Previous works have shown that laminin substratum could enhance myoblast adhesion, promote myoblast proliferation, and migration (Kuhl et al., 1982, 1986; von der Mark and Kuhl, 1985; Ocalan et al., 1988). Furthermore Foster et al. (1987) showed that rat skeletal myoblasts become responsive in terms of increased proliferation and differentiation to a laminin substratum at a particular stage during development. Since β1 integrin was not synthesized in the muscle masses in the wing bud (Critchlow and Hinchliffe, 1994), our data may support a role for cLBP as a functional receptor of laminin in regulating the proliferation, migration, and formation of the early muscle formation during limb morphogenesis.

On the other hand, previous studies suggested the possibility that 67 kDa LBP may have another function, serving a role in control of translation. Cytosolic protein (p40) from mouse cells, which is associated with ribosomes and polysomes, has shown similarity to the 67 kDa LBP (McCaffery et al., 1990; Auth and Brawerman, 1992). Several groups have also identified proteins from rat (Tohgo et al., 1994), sea urchin (Rosenthal and Wordeman, 1995), flies (Melnick et al., 1993), and yeast (Davis et al., 1992; Ellis et al., 1994; Demianova et al., 1996) with extensive sequence similarity to the 37/67 kDa LBP, and have shown that these proteins are apparently components of the ribosomal translational machinery.

Relation of cLbp expression to mesodermal cell differentiation in chick limb bud

Chick limb development depends on the continuous presence of the AER (Saunders, 1948; Summerbell, 1974a, b). Reciprocal interactions with the AER promote the growth of the underlying mesoderm (progress zone) and maintain it in an undifferentiated state (Globus and Vethamany-Globus, 1976; Solursh et al., 1981). FGF-2 is present at high concentrations during the early stage of chick limb bud development (Munaim et al., 1988; Seed et al., 1988; Savage et al., 1993), and it has been shown to mimic the effects of AER (Riley et al., 1993; Fallon et al., 1994). Msx1 is normally expressed in the AER and the progress zone mesoderm in early stage wing buds (Hill et al., 1989; Robert et al., 1989; Davidson et al., 1991; Yokouchi et al., 1991). The expression in the limb mesoderm is controlled by signals emanating from the AER (Ros et al., 1992; Robert et al., 1991), and FGF-2 has been shown to maintain Msx1 expression (Watanabe and Ide, 1993; Wang and Sassoon, 1995). Though the role of this protein itself in developing limb buds is at present unclear, myogenic cell lines that constitutively express Msx1 have been shown to become differentiation-defective (Song et al., 1992; Woloshin et al., 1995). These observations are consistent with the hypothesis that the AER is involved in the maintenance of the underlying mesoderm in an undifferentiated state via the regulation of Msx1 gene expression.

We showed that excision of the AER reduced the cLbp transcription level and that FGF-2 could recover the expression in mesodermal cells in a similar manner as Msx1 (Ros et al., 1992), indicating that cLbp expression in the limb mesoderm could be maintained by FGFs emanating from the AER. However cLbp expression remained in the distal mesoderm 12 hr after excision of the AER (not shown), although by this point Msx1 was undetectable (Ros et al., 1992). The expression patterns of cLbp and Msx1 differ during normal development: expression of Lbp is broader than that of Msxt These findings suggest that cLbp expression would not be regulated through the Msx1 cascade. cLbp expression in the chick limb bud was distributed as a gradient with the highest levels distally, and almost overlapped the Msx1 expression pattern. cLBP transcripts are also found in undifferentiated mesoderm at the tips of the facial primordia in a similar fashion to Msx1 (Brown et al., 1993). it has been demonstrated that the increased amount of 67 kDa LBP upregulates properties of malignant cells such as high metastatic potential and rapid growth (Cixe et al., 1991; Hand et al., 1985; Wewer et al., 1987), and that the expression of the 67 kDa LBP and its mRNA are dramatically reduced in differentiated neuroblastoma cells (Bushkin-Harav et al., 1995) and colon carcinoma (Yow et al., 1988; Mafune et al., 1990). It therefore appears that the level of the 67 kDa LBP is closely related to cell differentiation, indicating a possibility that cLBP has a role in maintaining the progress zone mesoderm in an undifferentiated state during the development of the chick limb bud.