Subfamily Gochnatioideae was described (Panero & Funk, 2002) to include four genera of Mutisieae sensu Cabrera (1977), Cnicothamnus, Cyclolepis, Gochnatia, and Richterago, that form a well-supported clade in phylogenetic analysis of chloroplast DNA sequence data (Panero & Funk, 2008). There are no morphological synapomorphies for the subfamily; characters that have been used to define a Gochnatia complex (Freire et al., 2002) are also found in closely related taxa outside Gochnatioideae since the two Southeast Asian species of Gochnatia section Leucomeris were found to be sister to the genus Nouelia tribe Hyalideae of southwestern China (Panero and Funk, 2008). Sancho and Freire (2009) point out that genera of Gochnatioideae can be recognized by a combination of three characters including dorsally glabrous style branches, apiculate apical anther appendages and deeply dissected 5-lobed corollas. Except for Cnicothamnus and three species of Richterago (Roque & Pirani, 2014) members of the subfamily have discoid capitula. Gochnatioideae contains approximately 90 species distributed in South America, the Caribbean and Mexico.

A stable generic classification of the Gochnatioideae has not been reached mainly because of the difficulty in circumscribing the limits of the genus Gochnatia. Cladistic analyses of morphological characters show that Gochnatia as circumscribed by Cabrera (1971) is a polyphyletic genus (Bremer, 1994; Jiménez Rodríguez et al., 2004; Ventosa-Rodriguez and Herrera-Olivier, 2011a). Cabrera recognized six sections in the genus including Discoseris, Gochnatia, Hedraiophyllum, Leucomeris, Moquiniastrum, and Pentaphorus. Freire et al. (2002) synonymized section Moquiniastrum under sect Hedraiophyllum and recognized three additional sections, namely Anastraphioides, Glomerata and Rotundifolia. The process of defining a natural Gochnatia started with the removal of species of Gochnatia section Discoseris and placing them in Richterago (Roque & Pirani, 2001). Hind (2007) recognized the two species of section Pentaphorus at the genus level but Telleria et al. (2013) did not find pollen characters to differentiate it from other South American gochnatias. Anastraphia was recently resurrected (Ventosa-Rodriguez & Herrera-Olivier, 2011b) to accommodate all the Caribbean species of Gochnatia placed by Freire et al. (2002) in section Anastraphioides. A phylogenetic study using nrITS concatenated with several chloroplast markers (Funk et al., 2014) shows that Gochnatia s. l. is paraphyletic with the South American species placed in two clades, one with members of Gochnatia section Moquiniastrum sister to Richterago, and the other clade including taxa of Gochnatia sections Pentaphorus and Gochnatia and sister to all other species of the subfamily except Cyclolepis. The Mexican species of Gochnatia that were strongly supported as sister to Anastraphia have been recognized subsequently as a new genus, Nahuatlea (Funk et al., 2017). Despite a lack of significant statistical support for the relationships of the three clades of South American Gochnatia representing sections Gochnatia, Moquiniastrum and Pentaphorus, Funk et al. (2014) choose to recognize these three groups at the genus level.

The phylogenetic relationships of Cyclolepis to other Gochnatioideae and Wunderlichioideae in nuclear genomic studies of Asteraceae (Mandel et al., 2019) is equivocal, and conflicts with earlier Asteraceae phylogenies based on plastid data (Panero & Funk, 2008; Panero et al., 2014). In concatenated analysis of nuclear genomic data, a Cyclolepis –Wunderlichioideae clade is moderately supported as sister to Gochnatioideae. In coalescent-based species tree estimation, Cyclolepis is sister to Gochnatioideae but these are collectively sister to Wunderlichioideae rather than a Hecastocleidoideae - Asteroideae clade as reconstructed from chloroplast DNA.

To ascertain generic relationships in Gochnatioideae I undertook a sequence analysis of ITS and ETS regions of the nuclear ribosomal DNA. In particular, I aimed to (1) evaluate the monophyly of the South American Gochnatia and (2) determine the relationships of Nahuatlea to other genera of Gochnatioideae.

Materials and Methods

Taxonomic Sampling. Sampling was informed by previous molecular studies (Panero & Funk, 2008; Funk et al., 2014) and the taxonomic revision of Gochnatia (Cabrera 1971, Freire et al., 2002). Nomenclatural types for all sections of Gochnatia were included except for those of sect Rotundifolia and sect. Hedraiophyllum that were not available. All species of Nahuatlea were sampled. Exemplars of six genera from the basal grade of Asteraceae clades outside Gochnatioideae were also included: Stifftia (Stifftioideae), Hyalis, Ianthopappus, Leucomeris, Nouelia of the Hyalideae, and Wunderlichia (Wunderlichieae, Wunderlichioideae). The genus Plazia of Mutisioideae served as outgroup. A list of the 40 species, including 33 Gochnatioideae, analyzed in the study is provided in Appendix 1.

Molecular Methods. Total genomic DNA was isolated from field-collected leaves preserved in liquid nitrogen, CTAB solution or silica using the CTAB method (Doyle and Doyle 1987) modified to include a one volume phenol-chloroform-isoamyl alcohol extraction and two 70% ethanol washes. Total DNA was resuspended in water - 7 M sodium acetate (10:1), precipitating the DNA with one volume of ethanol, followed by two ethanol washes. Herbarium and some silica-preserved samples were isolated using the DNeasy^® Plant Mini Kit from Qiagen, Inc. (Qiagen Sciences, Germantown, MD, USA).

DNA fragments were amplified using the polymerase chain reaction (PCR) in 50 µl reactions with 2 units of Taq polymerase, 0.2 M Tris-HCl, 8 mM (NH₄)₂SO₄, 0.2 mM dNTPs, 5 mM MgCl₂, 20 µM of primers, target DNA and water to a volume of 50µl. PCR amplification protocols for the ITS and ETS included the following steps: 95 °C for 4 min, 50 °C for 45 s, 72 °C for 1 min followed by 36 cycles of 95 °C for 1 min, 50 °C for 45 s, 72 °C for 1 min with a 2 s extension per cycle and a final extension of 72 °C for 8 min (Rivera et al., 2016). Primers 18S-ETS (Baldwin and Markos, 1998) and a newly developed primer ETS-Goch (5′ GAT GTC TGC TTG CGC AGC AAC G-3′) were used to amplify and sequence the ETS region. The ETS-Goch primer was developed to amplify the ETS region of the nuclear ribosomal IGS for the basal lineages of the Asteraceae. The ETS primer in the IGS region developed for tribe Madieae of the Heliantheae alliance (Baldwin and Markos 1998) did not amplify a majority of samples of subfamilies Barnadesioideae, Gochnatioideae, Mutisioideae, Stifftioideae, or Wunderlichioideae. The ETS primer developed for tribe Cardueae (Kelch and Baldwin, 2003) was used instead but this only amplified a very weak product for the genus Cnicothamnus. The Cnicothamnus ETS fragment was cloned using the TOPO TA cloning kit (Invitrogen, Carlsbad, CA, USA) and sequenced with the plasmid primers T7 and M13R to obtain the ETS primer sequence for Cnicothamnus. ETS-Goch was used to amplify most sequences included in this study. The ITS region was amplified using primers ITS 5 and ITS 4 of White et al. (1990) and occasionally primer ITS 7.5 (GAGTCATCAGCTCGCGTTGAC TA; Plovanich and Panero, 2004) in lieu of ITS 5 in amplification and sequencing reactions. Genbank accession numbers for the resulting sequences are provided in Appendix 1.

Sequences were edited using Sequencher v 4.9 (Gene Codes Corporation, Ann Arbor, USA) and assembled into primer-based matrices. Matrices were exported as Nexus interleaved files and concatenated in Paup* 4.0a build 163 (Swofford, 2002) then imported into Mesquite v 3.04 (Maddison and Maddison, 2015) to produce nbrf files. Alignment of the nbrf-formatted files was performed at the European Bioinformatics Institute website ( http://www.ebi.ac.uk/Tools/msa/mafft) using MAFFT (Katoh and Standley, 2013). The aligned matrices were imported into Mesquite, edited for minor changes in homology and subsequently exported as simplified Nexus interleaved files and concatenated in Paup* v. 4.0a, build 166. The concatenated matrix was exported as a simplified Nexus sequential file to use in phylogenetic analyses.

Phylogenetic analyses. Bayesian phylogenetic analyses were performed for the ITS plus ETS concatenated dataset. Models of molecular evolution were evaluated under the Akaike Information Criteria (Akaike, 1974) using the program MrModeltest 2.1 (Nylander, 2004). Number of informative characters was calculated by PAUP* (Swofford, 2002). The concatenated dataset was treated as a single partition with the model of evolution chosen using MrModeltest 2.1 specified as GTR + G + I. Two independent runs of four Markov chains, each starting with a random tree for 40 million generations was implemented, sampling trees at every 5,000^th generation. Stationarity of the chains was ascertained using ESS (Effective Sample Size) values above 200 as viewed in Tracer v1.7.1 (Rambaut et al., 2018) and Mr. Bayes 3.2.6 (Ronquist et al., 2012). The first 10% of the trees were discarded as burn-in samples. The 50% majority rule consensus tree was calculated by MrBayes 3.2.6 (Ronquist et al., 2012). Analyses were performed in the Cyberinfrastructure for Phylogenetic Research (CIPRES) cluster (Miller et al., 2015,  https://www.phylo.org). A maximum clade credibility (MCC) tree was constructed in TreeAnnotator v1.10 (Rambaut et al., 2018) depicting the maximum sum of posterior clade probabilities and visualized and edited in FigTree v.1.4.3 (Rambaut et al., 2018,  http://tree.bio.ed.ac.uk/software/figtree/).

Corolla and trichome morphology was observed and recorded under polarized light using a Nikon Eclipse Ni compound light microscope at the microscopy and imaging facility of the University of Texas.

Results

The aligned ITS and ETS matrix was 1079 base pair (bp) long (669 bp for ITS, and 410 bp for ETS) of which 575 characters were constant and 378 of these were parsimony-informative.

Gochnatioideae was polyphyletic because Cyclolepis was sister to all other genera of the subfamily and Wunderlichia (Wunderlichioideae), but statistical support was below a 0.99 significance threshold (95-98%, Fig. 1). All genera of Gochnatioideae were monophyletic except for Nahuatlea. Nahuatlea was supported in a clade with Anastraphia, but N. magna alone was strongly supported as sister to Anastraphia. Nahuatlea hypoleuca, the type species, formed a clade with three other nahuatleas, that with a well-supported N. arborescens + N. smithii clade formed a grade (Fig. 1). Cnicothamnus was supported in a clade with Gochnatia, Richterago+Nahuatlea (including N. magna), and Anastraphia, but its position sister to Richterago and collectively sister to Gochnatia resolved with less than 95% statistical support.

Discussion

Phylogenetic analysis of nrITS+ETS (Fig. 1) provided strong evidence to support recognition of a monophyletic Gochnatia that includes three of the six sections of the genus recognized by Cabrera (1971), namely sections Gochnatia, Moquiniastrum (including G. cordata) and Pentaphorus, and G. palosanto of section Hedraiophyllum. This novel concept excludes the Caribbean and Mexican species of Gochnatia that have been recently transferred to the genera Anastraphia and Nahuatlea, respectively (Ventosa-Rodriguez and Herrera-Oliver 2011b; Funk et al., 2014; 2017). An alternate taxonomic view that recognizes Moquiniastrum and Pentaphorus at generic rank is similarly consistent with the ITS+ETS phylogeny. However, the paraphyletic relationship found in Funk et al. (2014) lacks significant statistical support, thus there is no phylogenetic impediment to accepting these in Gochnatia. Gochnatia as here circumscribed can be separated from other Gochnatioideae by a distinctive combination of morphological characters including discoid capitula, a shrubby habit, and curled or reflexed corolla lobes.

The genus Nahuatlea, is currently circumscribed is polyphyletic in the ITS+ETS phylogeny. Nahuatlea magna was strongly supported as sister to Anastraphia and herein recognized as a new monospecific genus, Tehuasca (Tehuasca magna in Fig. 1). There is evidence for the Nahuatlea arborescens + N. smithii clade outside the type-containing Nahuatlea clade but its phylogenetic position is not statistically supported so taxonomic assessment is equivocal. Tehuasca magna, a small shrub or small tree with broadly ovate leaves from central-northeastern Mexico, shares with most Anastraphia species pubescent corollas as opposed to glabrous as in nahuatleas (Fig. 2). Whereas most species of Anastraphia have well-developed spiny mucros, Tehuasca has entire margins.

Excluding the South American monotypic genus Cyclolepis from Gochnatioideae, the ITS+ETS phylogeny shows two sister lineages of the subfamily (Fig. 1) each of which contains genera that are geographically confined to either North or South America. Anastraphia and species originally described in Nahuatlea are North American/ Caribbean, whereas Gochnatia, Richterago and Cnicothamnus are South American endemics (Fig. 1). Cyclolepis, Wunderlichioideae, as well as more basal Asteraceae are South American in origin. Based on our phylogeny, the North American lineage is, probably, the result of long distance from South America. Diversification and dispersal in Mexico ultimately resulted in later spread to the Caribbean and allopatric speciation of Anastraphia on multiple islands.

Nahuatlea magna is recognized as a new, monospecific genus, Tehuasca. Of all the species of North American Gochnatioideae, Tehuasca magna is the most hygrophytic with populations of the species found in tropical, seasonally dry, xerophytic to moist forests.

Similar to Anastraphia in having deeply dissected corollas and globular glandular trichomes on the abaxial surface of corollas but differs in having leaves with entire margins, coiled corolla lobes, and mostly creamy white, sometimes pale yellow, corollas.

Fig. 1.

Phylogenetic relationships among genera of Gochnatioideae based on Bayesian analysis of nuclear ribosomal internal and external transcribed spacer DNA sequences. Subfamily or tribal names label branches leading to the most recent common ancestor.

Fig. 2.

Polarized light micrographs of corollas of representative species of North American and Caribbean Gochnatioideae. A. Tehuasca magna (Servin 1457, TEX). Arrow points to biseriate grandular trichomes at distal ends of corolla lobes. B. Nahuatlea hypoleuca (G. B. Hinton 18096, TEX). Arrow points to glabrous abaxial surface of corolla lobe. C. Nahuatlea smithii (Ortega 121, TEX). Arrow points to glabrous abaxial surface of corolla lobe. D. Anastraphia sessilis (García & Pimentel 787, TEX). Arrow points to biseriate glandular trichomes at abaxial, distal end of corolla lobes.

Shrubs or small trees. Leaves alternate, simple, petiolate, blades ovate to ovate-obovate, rarely suborbicular, apices acute to acuminate, leaf margins entire. Capitulescences of simple cymes. Capitula discoid, involucre campanulate, phyllaries in 5-6 series, phyllaries imbricate. Disc flowers 40-80, creamy white or yellow, abaxial surface mostly glabrous except for the distal end of lobes that are covered with mostly biseriate glandular trichomes, lobes coiled. Anthers five, white, with small tails and narrowly lanceolate appendages, endothecial cells with polar thickenings, cells of the appendages and distal third of anthers sclerified. Styles with short, acuminate lobes, yellow, glabrous. Cypselae densely sericeous, silvery, pappus of multiple, stramineous bristles of equivalent length, distal end of bristles slightly expanded.

Tehuasca is endemic to the tropical moist and deciduous forests of eastern central/northern Mexico in the states of Guanajuato, Hidalgo, Queretaro, San Luis Potosi, and Tamaulipas. The name Tehuasca is an anagram of Huasteca. A significant portion of the geographic range of Tehuasca is within the boundaries of the Huasteca or Huasteca Potosina region, the pre-Columbian home of the Huasteca people. The Huasteca is a region of unusual beauty whose numerous limestone mountains have been eroded by multiple surface and underground rivers.

Shrubs or small trees 2-5 m tall. Leaves alternate, simple, petiolate, petioles 0.4-12 mm long, blades ovate to ovate-obovate, rarely suborbicular, apices acute to acuminate, leaf margins entire, adaxial surface green, sparsely pubescent, abaxial surface creamy in color, densely pubescent, approximately 3-10 cm long, 1.5-7 cm wide. Capitulescences of simple cymes with 2-9 capitula. Capitula discoid, involucre campanulate to urceolate, 1.2-1.7 cm long, 1-1.5 cm wide, phyllaries in 5-6 series, phyllaries imbricate, densely pubescent on abaxial surfaces, pubescence gradually decreasing from base to tip, distal end of phyllary glabrescent to glabrous, apices acuminate ending in a small mucro. Disc flowers 40-80 creamy white or yellow, abaxial surface mostly glabrous except for the distal end of lobes that are covered with mostly biseriate glandular trichomes, the trichomes with broadly expanded, globular, terminal cells, lobes coiled. Anthers five, white, with small tails and narrowly lanceolate appendages, endothecial cells with polar thickenings, cells of the appendages and distal third of anthers sclerified. Styles with short, acuminate lobes, yellow, lobes 0.4 mm long, glabrous. Cypselae moderately to densely sericeous, silvery brown, 3.5-4 mm long, pappus of multiple, stramineous bristles of equivalent length, distal end of bristles slightly expanded.

Tehuasca magna, as the species epithet implies, has large capitula arranged in simple cymes with multiple series of imbricate phyllaries. However, these capitula are not the largest of the North American Gochnatioideae. The relatively recently described Nahuatlea hiriartiana (González Medrano et al., 2004) from the desert region of Hidalgo state in central Mexico has the largest capitula of the group. Cabrera (1971) stated that Tehuasca magna shares several characteristics with Gochnatia arborescens including broadly ovate leaves and capitulescences with few capitula arranged in condense, simple cymes or glomerules, but that their capitula were quite different. According to Cabrera the involucre of N. arborescens is campanulate-turbinate but campanulate in T. magna, the phyllaries are arranged in 8-10 series (vs. 5-6 series in T. magna) and the number of flowers is quite different with N. arborescens having 13-20 flowers vs. 40-80 in T. magna.