Introduction

Gymnopodium floribundum Rolfe is an important component of the seasonal forests and savannahs of southern Mexico, Guatemala and Belize from sea level up to 1000 m (Miranda 1952; Flores & Espejel 1994; Goodwin & al. 2013). Along its distribution area, G. floribundum exhibits variation in shape, size and degree of pubescence of leaf blades, inflorescences, flowers and fruits, and hence two varieties have been described. However, Ortiz-Díaz (1994; unpublished data) recognized only one highly polymorphic species. Phylogenetic studies in the subfamily Eriogonoideae confirm the monophyly of Gymnopodium Rolfe and place it as a sister group of the tribe Eriogoneae (Burke & al. 2010; Burke & Sánchez 2011).

During the review of herbarium specimens for the taxonomic treatment of Gymnopodium for the Flora Mesoamericana project, a population from Toledo in the south of Belize, represented by a gathering made in 1997, showed a set of characters in leaf, inflorescence, flower and fruit different from those described for G. floribundum; however, only three specimens of the same population were available. Due to the limited collections, we wanted to look for new characters to support the morphological ones, so we carried out a molecular study using the nuclear markers ITS1, 5.8S and ITS2 as well as lfy (exon2 and intron 2). The ITS1, 5.8S and ITS2 markers have been used in the last two decades as excellent barcodes for several groups of angiosperms because of their short length and easy amplification (Hoot & Taylor 2001; Lee & al. 2002; Kress & al. 2005; Cowan & al. 2006; Pang & al. 2011; CPBOL 2011; Liu & al. 2014; Michel & al. 2016; Nithaniyal & Parani 2016). Moreover, the lfy marker has also been used in phylogenetic studies and species delimitation (Hoot & Taylor 2001), particularly in Polygonaceae (Schuster & al. 2011; Sánchez & Kron 2011). This work describes G. toledense Ancona & Ortiz-Díaz as a new species using an integrative approach to include diagnostic characters of morphology and multiple DNA loci.

Material and methods

Morphological studies — The present study was based on a morphological and biometrical analyses carried out on material collected by two of the authors and on material preserved in the herbaria BM, CHIP, CICY, HEM, MEXU, MO and UADY (herbarium codes according to Thiers 2018+). All the studied material was compared and measured to the nearest 0.1 mm using the Absolute Digimatic Mitutoyo digital calliper.

Plant selection for molecular studies — Based on the distribution and morphological variation, 29 individuals representing eight populations of Gymnopodium were collected by the first author in Mexico. Two further samples of Gymnopodium from Belize were obtained from herbarium collections (in MO) to complete the sampling. Unfortunately, we could not find any individuals of G. toledense during our field trip in 2016 to re-locate the Toledo population because the landscape there has been drastically transformed since 1997. Coccoloba uvifera (L.) L. and Podopterus mexicanus Bonpl. were selected as outgroups according to Burke & al. (2010). All Mexican specimens were deposited in the herbarium UADY. For further details see Table 1. Foliar tissue from new leaves was collected from three or four individuals at each population and maintained in silica gel to transport it to the Biodiversity and Ecophysiology Laboratory of the Universidad Autónoma de Yucatán. Then, in the lab, we proceeded to extract and isolated DNA from each sample.

DNA isolation, amplification, sequencing — DNA was purified from 50 mg of foliar tissue of three or four individuals of each Mexican population and from each herbarium specimen from Belizean populations (Table 1) using the DNeasy Plant mini Kit (QIAGEN). Genomic DNA was amplified for ITS1, 5.8S and ITS2, using ITS5 (GGAAGTAAAAGTCGTAACAAGG) and ITS4 (TCCTCCGCTTATTGATATGC) primers from White & al. (1990); and lfy (exon2 and intron 2) using lfy2i1 (CCTGCCGACATANTGGCGCATCTTGGGCTT) and lfy23 (TGCAAGGGGTAAGAAGAACGGCCTTGA) primers from Sánchez & Kron (2011). All amplifications were conducted in a 10 µl reaction using the standardized protocol of Sánchez & Kron (2009). Amplified fragments were visualized in 0.8 % agarose gels. Bands with the expected size for the amplicons were purified with the Pure Link ® Quick Gel PCR Purification Combo Kit for Sanger sequencing in Macrogen Inc., South Korea. Homology of the sequences was tested using the sequence from Ancona & Ortiz 186 in BLAST using the module megaBLAST search (Morgulis & al. 2008) from NCBI and confirmed with the retrieval of sequences of the same region from Gymnopodium floribundum and other Polygonaceae species mostly of the genera Ruprechtia C. A. Mey. and Triplaris Loefl.

Sequences for ITS1, 5.8S and ITS2 did not include ambiguous nucleotide calls, suggesting that each individual is homozygous for this locus. All lfy (exon2 and intron 2) sequences did include ambiguous nucleotide calls for several sites, suggesting that each individual is heterozygous for this locus. Alleles per individual were inferred using DNAsp v.6 (Rozas & al. 2017).

Phylogenetic analyses — The nucleotide data matrix for ITS1, 5.8S and ITS2 contained 32 sequences, as did that for lfy (exon2 and intron 2). For each region, the alignment was obtained using ClustalW algorithm (Thompson & al. 1994), as implemented in MEGA v 6.0 (Tamura & al. 2013), and then visually checked.

To delimit this new species, we employed the phylogenetic species concept, which defines a species as: “the smallest aggregation of (sexual) populations or (asexual) lineages diagnosable by a unique combination of character states” (Wheeler & Platnick 2000). The distance approach was used to infer if Gymnopodium floribundum and G. toledense aggregate as unique or separate entities (monophyletic groups) in the neighbour-joining trees obtained for each one of the regions. The neighbour-joining trees was computed by the maximum composite likelihood method (Tamura & al. 2004), and clustering of the branches were tested using 500 bootstrap replications (Felseinstein 1985), as implemented in MEGA v 6.0 (Tamura & al. 2013). For the final analyses, all positions containing gaps and missing data were excluded.

Distribution map — The distribution map of Gymnopodium floribundum and G. toledense was made using the SimpleMappr program (Shorthouse 2010) and geographic coordinates of herbarium specimens databased in Tropicos ( http://www.tropicos.org).

Fig. 1.

Neighbour-joining optimal tree using ITS1, 5.8S and ITS2 sequences; percentage of 500 replicates that subtended nodes are shown next to branches; collector and number refer to specimen voucher column in Table 1.

Results and Discussion

The diagnostic morphological characters between Gymnopodium floribundum and G. toledense are shown in Table 2. Gymnopodium toledense differs from G. floribundum by, e.g., its sparse or dense glandular trichomes on the leaves, inflorescences and flowers, and its longer inflorescences and perianth segments. All the G. floribundum specimens examined lack the basal gland on the trichomes, and their racemes and perianth segments are shorter than those of G. toledense (see also Ortiz-Diaz 1994).

The total length of the ITS1, 5.8S and ITS2 sequence was 745 sites including gaps and for the lfy sequence 562 sites including gaps. The sequence from Ancona & Ortiz 186 obtained from the BLAST search for ITS1, 5.8S and ITS2 has a 98 % identity to the sequence of the same region from Gymnopodium floribundum (GB GQ206251). The lfy (exon2 and intron 2) sequence from Ancona & Ortiz 186 has a 92 % identity to sequences of the same region from G. floribundum (GB HQ693138.1), and included sequences of the same region from Coccoloba swartzii Meisn. (GB EF442787.1) and Gilmania luteola (Coville) Coville (GB EF438069.1).

The neighbour-joining trees built with molecular data show Gymnopodium toledense separated from G. floribundum (Fig. 1 & 2). The sum of the branch lengths was 0.60421319 for the ITS1. 5.8S and ITS2 and 4.68968630 for the lfy (exon2 and intron 2) trees. The bootstrap support values for the nodes grouping G. toledense and G. floribundum were 98 % for ITS1, 5.8S and ITS2 and 97 % for lfy (exon2 and intron 2). The bootstrap support values for the nodes connecting the G. floribundum terminal branches were 66 % for ITS1, 5.8S and ITS2 and 38% for lfy (exon2 and intron 2). The molecular data of ITS1, 5.8S and ITS2 and lfy (exon2 and intron 2) markers provided numerous substitutions to delimit both species.

The neighbour-joining trees showed G. toledense as the sister species of G. floribundum (Fig. 1 & 2). The ITS1, 5.8S and ITS2 and lfy (exon2 and intron 2) markers have been successfully used to infer relationships between species of Ruprechtia and Triplaris (Sánchez & Kron 2011) and of Fallopia Adans., Muehlenbeckia Meisn. and Reynoutria Houtt. (Schuster & al. 2011).

The morphological and molecular characters allowed us to clearly define the boundaries between Gymnopodium floribundum and G. toledense. Such evidence supports the proposal of G. toledense as a new species. Moreover, both phylogenetic trees built with the ITS1, 5.8S and ITS2 and lfy (exon2 and intron 2) markers suggest that G. floribundum is a polymorphic taxon. Further studies including morphometry and chloroplast markers could provide new evidence to confirm this hypothesis.

Taxonomic treatment

Gymnopodium toledense Ancona & Ortiz-Díaz, sp. nov. – Fig. 3.

Holotype: Belize, Toledo, Las Sierritas, 20 km W of Big Creek Settlement, ridge and W slopes of Cerrito in Las Sierritas hills, 16°31′45″N, 88°36′05″W, 160–213 m, ridge-top vegetation of mixed hardwood species growing on thin soils over exposed limestone, vegetation severely damaged by recurrent fires, 6 Dec 1997, T. Hawkins 1681 (MO [barcode  MO-321695 accession no. 04950838]; isotypes: BM [barcode  BM000565699], MEXU [catalogue no. 898235]).

Morphological diagnosis — Gymnopodium toledense differs from G. floribundum by bearing trichomes with basal glands on the petioles, leaf blades, inflorescence rachis, pedicels and ovary, prominent veins on the abaxial surface of the leaf blade, and the basal segment of the pedicel hidden by the ochreole (see also Table 2).

Fig. 2.

Neighbour-joining optimal tree using lfy (exon2 and intron 2) sequences; percentage of 500 replicates that subtended nodes are shown next to branches; collector and number refer to specimen voucher column in Table 1; “(2)” indicates second allele.

Morphological description — Shrubs often scrambling, 2–4 m tall; bark grey to dark brown, fissured; young branches divaricate, flexuous, grey to pale brown; internodes 2–3 cm long; ochrea deciduous, annular, c. 1 mm long, sparsely pubescent, trichomes with basal glands. Leaves alternate, arising from ochrea, fasciculate (2 or 3 together) on small vegetative shoots (brachyblasts), simple; petiole 1.5–2 × c. 1 mm, canaliculate, densely pubescent, trichomes dark brown, 0.3–0.5(–7) mm long with basal glands; leaf blade obovate to obpyriform, 5–7 × 3–4 cm, chartaceous, base obtuse, margin entire, apex obtuse to slightly emarginate; veins prominent abaxially; abaxial surface of leaf blade densely pubescent, trichomes 0.3–0.5 mm long with basal glands, adaxial surface glabrous except puberulent on midvein. Inflorescence terminal; racemes single or paired, on brachyblasts, 12–20 cm long; rachis 15–18 cm long, densely pilose, trichomes 0.3–0.5(–0.7) mm long with light yellow basal glands; flowers in fascicles of 2–4(–6); ochreoles lanceolate, 1–2 mm long, membranous, sparsely to densely pubescent, trichomes with basal glands; pedicels articulated below middle, basal segment 0.5–1 mm long, hidden by ochreole, distal segment 5–6.5(–8) mm long, densely pubescent, trichomes 0.3–0.5(–8) mm long with basal glands. Flowers hermaphrodite; perianth segments 6, 3 outer and 3 inner; outer segments greenish yellowish, ovate-orbicular to cordate, 8.5–9(–9.5) × 6–6.5(–7) mm, papery, sparsely to densely pubescent when young, glabrous to pubescent when mature, persistent and accrescent in fruit, reticulate; inner segments subulate-lanceolate, smaller than outer ones, (5–)5.5–6 × 1.5–1.8(–2) mm, papery, glabrous when young to scarcely pubescent when mature, apex long acuminate; stamens 6, filiform, outer 3 inserted into a basal disk, inner 3 arising opposite ovary grooves; filaments c. 2 mm long; anthers versatile, suborbicular, 0.5–0.7 mm long, bilocular, dehiscence longitudinal. Ovary superior, sessile, trigonous, compressed, to 1 × c. 0.5 mm, unicarpellate, unilocular, densely pubescent at vertices, trichomes with basal glands; styles 3, filiform, 1.5–1.7 mm long; stigmas 3, capitate. Fruit an achene, light brown, lustrous, trigonous, 5(–5.5) × 2(–2.5) mm, smooth, included in perianth segments; seed 1.

Fig. 3.

Gymnopodium toledense – A: petiole and basal portion of leaf blade; B: young and mature flowers, showing rachis, outer and inner perianth segments and pubescent ovary; C: detail of pedicel, showing trichomes with basal glands. – Drawn by Jesús Elías García López based on the holotype.

Distribution and ecology — Gymnopodium toledense is so far known as an endemic species of the seasonal forests of southern Belize (Fig. 4), in the biogeographic region of Eastern Central America. It could possibly be found also in Guatemala and Honduras. Conservation status — Gymnopodium toledense is currently known only of the population last recorded in December 1997 at Las Sierritas in the Toledo district of southern Belize. Our efforts to find the population during our field work in 2016 were not successful owing to the landscape having undergone a drastic transformation since 1997, and indeed the field notes of the type gathering included “vegetation severely damaged by recurrent fires”. Therefore, the new species meets the following IUCN (2012) criteria for the category Critically Endangered (CR): B1 = Extent of Occurrence estimated to be less than 100 km²; a = severely fragmented or known to exist at only a single location; and b(iii) = continuing decline, observed, inferred or projected, in area, extent and/ or quality of habitat; i.e. CR B1ab(iii). Further exploration is needed through the seasonal forests of southern Belize and adjacent areas of Guatemala and Honduras to assess the frequency and status of any extant subpopulations.

Fig. 4.

Distribution map of Gymnopodium floribundum () and G. toledense ().

Etymology — The specific epithet refers to the area where this species was collected, Toledo district, Belize.

Key to the species of Gymnopodium

1. Leaves, inflorescence rachises and pedicels glabrous or covered with sparse to dense simple trichomes without basal glands; veins not prominent on abaxial surface of leaf blade; pedicel basal segment not hidden by ochreole; outer perianth segments 6.5–8 × 5–6.5(–7) mm; inner perianth segments (4–)4.5(–5) × 1–1.5 mm; fruit 4–4.5(–5) × 1.5(–2) mm G.floribundum

- Leaves, inflorescence rachises and pedicels covered with sparse to dense simple trichomes with basal glands; veins prominent on abaxial surface of leaf blade; pedicel basal segment hidden by ochreole; outer perianth segments 8.5–9(–9.5) × 6–6.5(–7) mm; inner perianth segments (5–)5.5–6 × 1.5–1.8 mm; fruit 5(–5.5) × 2(–2.5) mm G. toledense

Table 1.

Taxa, localities, specimen vouchers, herbaria and GenBank accession numbers for the nuclear markers ITS1, 5.8S and ITS2 and lfy (exon2 and intron 2).

Table 2.

Morphological comparison between Gymnopodium toledense and G. floribundum.