DMY is a Y-specific DM-domain gene required for male development and appears to be the sex-determining gene in the teleost fish medaka, Oryzias latipes. Although the genomic region containing DMY appears to have originated through duplication of the DMRT1 region, it is unknown when the duplication occurred. Here we show that O. curvinotus also has the DMY gene on the Y chromosome, which is homologous to the Y chromosome of medaka, and that DMY is expressed in XY embryos. A phylogenetic tree based on the amino acid sequence including the DM-domain shows that DMY was derived from DMRT1 immediately before speciation of O. latipes and O. curvinotus.
INTRODUCTION
Although the sex-determining gene Sry on the Y chromosome has been identified as the testis-determining gene in mammals, no equivalent gene has been found in non-mammalian vertebrates. Recently, we found a Y-linked gene with properties consistent with that of a sex-determining gene in the medaka (Oryzias latipes). This gene, named DMY (DM-domain gene on the Y chromosome), encoded a protein that contains a DNA-binding motif called a DM-domain, which was originally described as a DNA-binding motif shared between doublesex (dsx) in Drosophila melanogaster and mab-3 in Caenorhabditis elegans (Raymond et al., 1998). DM-domain containing genes have also been found in many vertebrate species. One DM-domain containing gene, DMRT1 (DM-related transcription factor 1) appears to be involved in a sex-determining cascade (Raymond et al., 1999; Smith et al., 1999; De Grandi et al., 2000; Guan et al., 2000; Kettlewell et al., 2000; Marchand et al., 2000; Moniot et al., 2000).
In medaka, the nucleotide sequences of DMY and DMRT1 have a similarity of 83% (based on cDNA sequences) and the genomic region containing DMY appears to have originated through duplication of the DMRT1 region (Brunner et al., 2001; Nanda et al., 2002). We report here phylo-genetic relationships between O. curvinotus DMY and DMRT1, and discuss the time DMY acquired its sex-determining function.
MATERIALS AND METHODS
Linkage analysis
O. curvinotus was maintained by mass mating at Niigata University.
For genotyping, genomic DNA was extracted from a part of the caudal fin as described previously (Matsuda et al., 1997).
Genomic PCR was performed using the primers for O. latipes DMRT1 and DMY: PG17.25, CCCACCAGATCCTATACAAGTGAC; PG17.48, GGCTGGTAGAAGTTGTAGTAGGAGGTTT. PCR conditions were 5 min 95°C, followed by 30 cycles of 20 s at 96°C, 30 s at 55°C, 60 s at 72°C, followed by 5 min at 72°C. The primers for Casp6 were described previously (Kondo et al., 2001).
Expression analysis
Genomic DNA and total RNA were extracted from each hatched embryo as described (Matsuda et al., 2002). Genomic PCR was performed using primers for DMRT1 and DMY as described above. RT-PCR was performed using a OneStep RT-PCR kit (Qiagen). PCR conditions were 30 min at 55°C; 15 min at 95°C; 20 s at 96°C, 30 s at 55°C, 60 s at 72°C for 30 cycles; and 5 min at 72°C. Approximately 100 ng of total RNA was used as template. For RT-PCR of DMY, the same primer set of genomic PCR was used. The PCR conditions and specific primers for PG04 were described previously (Matsuda et al., 2002). RT-PCR products were confirmed by direct sequencing.
Phylogenetic analysis
A phylogenetic tree was constructed using MEGA2 software (Kumar et al., 2001) in which distances were made to be proportional to the number of different amino acids. Human DMRT2 was used as an outgroup.
RESULTS AND DISCUSSION
Because the nucleotide sequence of DMY is similar to that of DMRT1, many PCR primers can be used on both genes. We found that a PCR primer pair designed for DMY and DMRT1 of medaka could amplify DMY and DMRT1 of O. curvinotus (Fig. 1). To determine whether DMY is on the Y chromosome of O. curvinotus, we first checked the O. curvinotus genome of our stock by using PCR of DMY and Casp6, respectively. Casp6 is a DNA marker that has been reported to be sex-linked in O. latipes and O. curvinotus (Kondo et al., 2001). In our stock, males have DMY and are heterogametic in Casp6, whereas females do not have DMY and are homogametic in Casp6. We then mated males and females and obtained 57 offspring (30 males and 27 females). All the male progeny had the paternal genotype, whereas all the female progeny had the maternal genotype. This result indicates that O. curvinotus also has an XX-XY sex-determining system and that DMY is located on the Y chromosome, which is homologous to the medaka Y chromosome.
Fig. 1
Genomic and RT-PCR analyses of DMRT1 and DMY of embryos just after hatching. Some of results are shown. Lanes 1–4 show each embryo. Genomic PCR products were electrophoresed in a 1% agarose gel with a 1-kb DNA ladder, whereas RT-PCR products were electrophoresed in a 2% agarose gel with a 100-bp DNA ladder.
Furthermore, we obtained cDNA sequences of the coding region of DMY (from embryos) and DMRT1 (from testis) by the RACE method. A cDNA sequence of DMY was found to encode a putative protein of 280 amino acids, whereas a cDNA sequence of DMRT1 was found to encode a putative protein of 276 amino acids (Fig. 2). A phylogenetic tree based on the amino acid sequences of the DM-domains of these and other DMY and DMRT1 in the database indicated (Fig. 3) that Oryzias DMY made a clade with Oryzias DMRT1. The monophyly of Oryzias DMY/DMRT1 was supported by a 98% bootstrap value. The clade was divided into two lineages; one consisted of the DMYs of O. latipes and O. curvinotus, and the other consisted of the DMRT1s of these two species. The bootstrap value of the former clade was high (86%), while that of the latter clade was low (42%). These results suggested that DMY was derived from DMRT1 immediately before speciation of O. latipes and O. curvinotus.
Fig. 2
Alignment of DMY and DMRT1 proteins in O. latipes (Ola) and O. curvinotus (Ocu). Period indicates sequence identity; dash indicates a gap; asterisk indicates a stop codon. The DM-domain occurs at positions 23-76. A single base pair deletion at position 272 of Ola DMY has caused a frame-shift mutation. The DNA Data Bank of Japan (DDBJ) accession numbers of the O. curvinotus DMY and DMRT1 cDNA sequences are AB091695 and AB091696.
Fig. 3
A neighbor-joining tree based on the amino acid sequences from positions 21 to 109 in Fig. 2. The GenBank accession numbers of the sequences used in the tree were as follows: AF203489 (tilapia DMRT1), AJ295039 (fugu DMRT1), AF209095 (rainbow trout DMRT1), AF202778 (mouse DMRT1), AF130728 (human DMRT1) and AF284223 (human DMRT2). The scores above each branch represent bootstrap values of 1000 times.
Oryzias curvinotus has the same sex-determining mechanism as medaka and has DMY on the Y chromo-some, which suggests that DMY also has a role in sex determination of O. curvinotus. The branch length of DMY is longer than that of DMRT1 in the phylogenetic tree (Fig. 3). This means that DMY has more mutations than DMRT1 and suggests that DMY accumulated these mutations after it acquired its sex-determining function. In other words, the rate of evolution of DMY, which is a Y-linked sex-determining gene, is higher than that of DMRT1, which is the origin of the Y-linked sex-determining gene. The rate of evolution of Sry, which is the sex-determining gene on the Y chromo-some of mammals, is also higher than that of Sox family genes (Bowles et al., 2000). These results suggest that a new sex-determining gene generated by a gene duplication event in the sex chromosome tends to evolve fast.
