Isolation of MAR DNA of 0–16 hours old Drosophila melanogaster embryos

Embryos (0–16 hrs old) were obtained from a laboratory population of D. melanogaster (Canton-S) maintained at 25° C. Embryos were collected and weighed. NuMat was prepared according to published protocol from 0.1 g of embryos (Mirkovitch et al. 1984) with modifications as mentioned in Pathak et al. (2007) (Figure 1). Briefly, nuclei were isolated in nuclear isolation buffer (15 mM Tris pH 7.4, 40 mM KCl, 1 mM EDTA, 0.1 mM EGTA, 0.1 mM PMSF, 0.25 mM spermidine, and 0.5% (v/v) Triton-X 100) with 0.25 M sucrose. The nuclear pellet was digested with digestion buffer (20 mM Tris pH 7.4, 20 mM KCl, 70 mM NaCl, 10 mM MgCl2, 0.125 mM spermidine, 1 mM PMSF, 0.5% Triton-X 100, 10 U/mL RNase In, and 40 U/µL DNase I) at 4° C for 1 hr to remove chromatin. Extraction was carried out sequentially with 0.4 M NaCl and then with 2.0 M NaCl, each for 5 min, in extraction buffer (10 mM Hepes pH7.5, 4 mM EDTA, 0.25 mM spermidine, 0.1 mM PMSF, 0.5% (v/v) Triton X-100). The final pellet after extraction was washed 2 times with wash buffer (5 mM Tris, 20 mM KCl, 1 mM EDTA, 0.25 mM spermidine, 0.1 mm PMSF), and DNA was isolated from the pellet using a DNeasy Blood and Tissue kit (Qiagen,  www.qiagen.com).

Preparation of MAR DNA library

The isolated MAR DNA was made blunt end with DNA polymerase I, large (Klenow) fragment (New England Biolabs,  www.neb.com) and ligated to pMOS blunt end vector (Amersham kit, GE Healthcare,  www.gelifesciences.com) according to the manufacturer's instructions. Transformed colonies were screened on blue-white selection and checked for inserts by restriction enzyme >digestions. DNA inserts in the plasmids were sequenced by the cycle sequencing method using the Big Dye terminator version 1.1 cycle sequencing kit (Applied Biosystems,  www.appliedbiosystems.com) and an ABI Prism 310 Automated DNA sequencer (Applied Biosystems) with M13F and T7 primers.

Figure 1.

A: Flow chart of steps used for the isolation of MAR DNA from Drosophila melanogaster embryos. B: Ethidium bromide stained 1% agarose gel showing size distribution of MAR DNA from D. melanogaster embryos. Genomic DNA (lane 1); MAR DNA (lane 2); Isolated MAR DNA digested with DNase I (lane 3); 100 bp DNA marker (Lane M). High quality figures are available online.

Analysis of library sequences

The library sequences were analyzed for MAR potential by MAR-WIZ program (Singh 2000) under the default parameters setting. The results are given in Table 1.

The MAR sequences were also analyzed for binding sites of DNA-binding proteins, such as boundary element associated factor, GAGA factor, zeste-white 5, suppressor of hairy wing, and dCTCF, using a bioinformatic tool known as “chromatin domain boundary element search tool — cdBEST” (Srinivasan and Mishra 2012). These proteins are know to interact with chromatin domain boundaries, and most of them have also been shown to bind with MARs. The results of the analysis are presented in Supplementary Table 1.

Figure 2.

A: Sequence of MAR18 (roo transposon) clone found in MAR of Drosophila melanogaster. B: Southern blot analysis of PCR amplified roo LTR and control regions. Left panel shows the resolution of PCR amplicons on a 1.2% agarose gel. roo LTR (lane 1), Wnt4 control (lane 2), Arc control (lane 3), Wnt6 control (lane 4), 100 bp ladder (lane M). The right panel shows Southern hybridization of the gel with 32P-labelled MAR DNA. High quality figures are available online.

Analysis of MAR18 (roo MAR) sequence

The library sequences were aligned with the Drosophila genome using NCBI-BLAST program ( http://www.ncbi.nlm.nih.gov/). Of these, the MAR18 sequence was found to correspond to the LTR of roo transposon. Before proceeding further with any analysis, we first wanted to validate that the LTR of roo was actually associated with NuMat. To do this, an in vivo MAR assay was performed. Primers were designed to PCR amplify a region that enclosed the MAR18 sequence in the LTR of roo element (forward primer: 5′CCGCCTCCTAAAATAGTCCC3′; reverse primer: 5′CCTTACCTTTGGTAGGGGGA3′; amplicon size: 299 bp). As controls, primers were designed that amplified sequences of the D. melanogaster genome from an exon (in arc gene: forward primer: 5′GGAGAGGATTCAGGGTCACA3′; reverse primer: 5′GTTAGGGGAGGAGGAGCAAC3′; amplicon size: 280 bp), an intron (in Wnt6 gene: forward primer: 5′GAGAGACGGGTTTCGTGAAC3′; reverse primer: 5′CTTACCAATCGACCTGCGTT3′; amplicon size: 514 bp), or an intergenic region (5′ of Wnt4 gene: forward primer: 5′GATCTAGGCCGCATGGTAAA3′; reverse primer: 5′CGAGAGCTGAACCGAAAATC3′; amplicon size: 497 bp). These control fragments were from regions close to roo insertions. The amplicons were resolved on a 1.2% TAEagarose gel and transferred onto Nylon NY+ membrane in 20X SSC by capillary transfer. MAR DNA (obtained as mentioned above from D. melanogaster embryos) was labelled with 32P-dATP by the random primer labeling method. Hybridization was carried out at 60° C in 0.5 M sodium phosphate/7% SDS for 16 hr. The blot was washed stringently and exposed to a phosphor-imager screen for 4 hr. The results are presented in Figure 2.

After validating that the roo LTR sequence was indeed retained in NuMat, in silico analysis of the transposon insertion sites in the Drosophila genome was performed. The NCBI-BLAST results were observed in a whole genome view. The 190 bp sequence was analyzed by MAR-WIZ to find out the sequences with high MAR potential. The roo MAR sequence was aligned to the previously identified MAR in gypsy transposon using CLUSTAL-W program ( www.clustal.org). The results are presented in Figure 3.

Analysis of genes that flank roo insertion sites in the Drosophila genome

The sequence locations of the roo transposon insertions in the whole genome of D. melano gaster were taken from FlyBase ( www.flybase.org). The coordinates of the flanking genes were obtained from the release 5.45 of D. melanogaster available in FlyBase. The nearest genes associated with the roo transposons (upstream, downstream, and those containing them) were extracted using an inhouse written PERL script. For each of the associated genes, FlyAtlas anatomical expression data were obtained from FlyBase. The results are presented in Supplementary Tables 2 and 3 and Figure 4.

Figure 3.

Analysis of roo MAR sequence. A: Genome view of distribution of roo MAR sequence in Drosophila melanogaster. B: Analysis of roo MAR with MAR-WIZ program. The regions with matrix association potential are shown as peaks in the graph. The matrix potential is shown on the Y-axis, and DNA in base pairs is shown on the X-axis. Sequences corresponding to the peaks are given below. Sequences relevant for MAR association are underlined. C: Sequence alignment of the roo MAR with the matrix-associated region of the gypsy transposable element using ClustalW program. On the gypsy sequence, topoisomerase II cleavage sites are marked with brackets and labelled 1–7. Sequences following ATC rule and an A-box are underlined. High quality figures are available online.

Isolation of MAR DNA from D. melanogaster embryos

NuMat was prepared from 0–16 hr old D. melanogaster embryos using standard protocol (Figure 1A). Standard nuclear isolation protocols use hypertonic salt extraction to remove digested DNA. Alternative protocols using low salt extraction have been developed with the argument that physiological levels of salt may better preserve the ultrasturcture. However, a survey of literature shows that both methods reveal similar ultrastructural features (reviewed in Nickerson 2001). We used the high salt extraction method, modified so that the salt extraction was performed slowly in a step-wise manner (from low to high salt) in the presence of mild detergent. This ensured that the extraction process is gentle and avoids artifacts. From the NuMat pellet, MAR DNA was isolated. The size of MAR DNA ranged between 100 and 500 bp. Upon digestion of the isolated MAR DNA with DNase I, it was confirmed that the isolated fragments were DNA and not RNA (Figure 1B). The MAR DNA library was made according to the protocol described in the Methods. Despite repeated efforts, cloning did not give many colonies, probably because the MAR DNA were AT rich sequences with secondary structures. Such sequences are not tolerated well by the bacteria and hence are difficult to clone (Godiska et al. 2010; Leach and Lindsay 1986). The obtained MAR DNA clones were checked for inserts by restriction digestion. The size of the inserts ranged from 100 to 500 bp, correlating well with the size of the MAR DNA used for ligation. The clones were sequenced, and all the sequences obtained were found to be unique (Table 1).

Figure 4.

Pie chart showing classification of roo transposons from Drosophila melanogaster genome based on expression of flanking genes. High quality figures are available online.

Analysis of the MAR DNA clones with MAR-WIZ and cdBEST programs

All the MAR clones were analyzed for the NuMat binding properties by in silico analysis. As no single property is attributed to NuMat association, we checked for AT%, origin of replication sites, topoisomerase II cleavage sites, AT richness (regularly spaced AT repeats), ATC rule (a stretch of 20 or more nucleotides of A, T, or C) ,and MAR score (all the individual parameters were considered, and those that had a potential higher than the threshold were given) with MARWIZ program (Singh 2000). Sixteen of the 35 sequences showed AT% of more than 60% (Table 1). Origin of replication sites were found in all the MAR sequences except 3. Two-thirds of the sequences showed AT richness. Sixteen sequences showed topoisomerase II sites. ATC rule was also followed by many of the clones, and most importantly all the clones showed maximum threshold for matrix association. All the sequences satisfied more than one rule of NuMat association. This analysis clearly indicated that the obtained sequences have potential to associate with NuMat, and the library represents a subset of the whole genome of MAR DNA sequences from D. melanogaster embryos.

The binding motifs of a few DNA binding proteins, such as boundary element associated factor, GAGA factor, zeste-white 5, dCTCF, and suppressor of hairy wing, were also checked for in the cloned sequences, as these proteins are reported to bind to chromatin domain boundaries as well as MAR sequences. Several boundaries have been shown to associate with NuMat, so whether any of the sequences had a potential for boundary activity was also checked. To check this, the cdBEST program (Srinivasan and Mishra 2012) was used. The program can be used for identification of recognition sequences of boundary interacting proteins as well as for identifying potential boundaries. The results (Supplementary Table 1) show that none of the MAR sequences cloned were predicted to be a potential boundary. Of the boundary/ MAR interacting proteins, the boundary element associated factor binding site was present in 10 sequences (∼29%), the GAGA factor binding site was present in 10 sequences (∼29%), and the zeste-white 5 binding site was present in 4 (∼10%) of the sequences. Although this data set is small, it indicates that all MAR sequences may not neccesarily act as boundaries and vice-versa. Further, MAR and boundary property, if present on the same sequence, may be separable and not overlapping.

LTR sequence from roo transposon is enriched in NuMat

One of the clones from the library, labeled as MAR18, corresponded to an 190 bp sequence in the LTR of roo retrotransposon (Figure 2A). The complete roo retrotransposon element is 8.7 Kb, with a terminal repeat of 429 bp (Kaminker et al. 2002). The association of roo MAR with NuMat was validated by the in vivo MAR assay by Southern blotting. Primers were designed to amplify the LTR region of roo encompassing the MAR18 sequence. As controls, exonic, intronic, and intergenic regions close to roo insertion sites in the Drosophila genome were used. A signal in the roo MAR lane indicates the presence of complimentary sequences in the labelled MAR pool used as a probe. The absence of signals in the other lanes indicates that those sequences were not present in MAR in situ (Figure 2B). This experiment confirmed that the roo LTR element is associated with the NuMat in vivo.

In silico analysis of roo MAR sequence

Upon BLAST analysis, roo MAR was shown to be present 250 times in the genome (56, 47, 44, 59, and 46 times on X, 2L, 2R, 3L, and 3R chromosomes respectively) (Figure 3A). roo MAR sequences were found both at intergenic and intronic regions but never in an exon. Sometimes it was present more than once within the same intronic or intergenic region. The sequence of roo MAR when analyzed using MAR-WIZ showed a region of maximum matrix association that extended from 95 bp to 135 bp of the LTR (Figure 3B). This region had an origin of replication sequence (ATTTA), a curved DNA sequence (TTTAAA), an A-box (AAATAAAA), and a region that conformed with ATC rule (underlined in the sequence). The other 2 regions with lower MAR potential also harbored origin of replication sequences and were AT rich. The sequence was further checked for its similarity with an already known MAR DNA sequence in Drosophila gypsy retrotransposon. Alignment showed overall 40–50% sequence similarity. In the gypsy MAR sequence, topoisomerase II recognition sites are labelled as 1 to 7, and regions showing ATC rule are underlined (Figure 3C) (Nabirochkin et al. 1998). The topoisomerase II recognition sequence numbered “7,” and the regions following ATC rule, showed high sequence conservation among gypsy and roo MAR. Furthermore, an A-box was present in both sequences. Thus, the 2 sequences were similar in regions important for MAR association.

Analysis of roo-flanking genes in the Drosophila genome

FlyBase showed 193 insertions of roo in the whole genome of which 151 were in the sequenced region. Of the 151 places where roo transposon was inserted, 85 sites had a gene in the vicinity of those expressed in testes and ovaries (Supplementary Tables 2, 3), a significant 56% of the 151 sequenced roo insertions. Of the rest, expression data for genes around 11% of the roo insertions were either not available or the genes were not expressed in adult tissue. The remaining 33% insertions had associated genes expressed in other tissues (Figure 4). This analysis indicated a potential role for roo transposon in genome organization and regulated expression of distant genes via NuMat association.