Open Access
Translator Disclaimer
1 January 2003 Gene Expression and the Physiological Role of Transforming Growth Factor-α in the Mouse Pituitary
Seema Sharma, Souichi Oomizu, Tomoshi Kakeya, Tohru Masui, Sakae Takeuchi, Sumio Takahashi
Author Affiliations +
Abstract

Transforming growth factor-α (TGF-α), a member of the epidermal growth factor (EGF) family, is produced within the mouse anterior pituitaries. However, the cell types of TGF-α-expressing cells and the physiological roles of TGF-α within mouse pituitary glands remain unclear. The aim of the present study was to localize TGF-α mRNA-expressing cells, and to clarify the involvement of TGF-α in estrogen-induced DNA replication in mouse anterior pituitary cells. Northern blot analysis demonstrated TGF-α mRNA expression in adult male and female mouse anterior pituitaries. In situ hybridization analysis of the pituitaries in these mice showed that TGF-α mRNA-expressing cells in the anterior pituitary are round, oval, and medium-sized. TGF-α mRNA was colocalized in most of the growth hormone (GH) mRNA-expressing cells, while only some of the prolactin (PRL) mRNA-expressing cells. DNA replication in the anterior pituitary cells was detected by monitoring the cellular uptake of a thymidine analogue, bromodeoxyuridine (BrdU) in a primary serum-free culture system. Estradiol-17β (E2) and TGF-α treatment increased the number of BrdU-labelled mammotrophs, indicating that E2 and TGF-α treatment stimulates the DNA replication in mammotrophs. Immunoneutralization of TGF-α with anti-TGF-α-antibodies nullified the E2-induced increase in DNA replication. RT-PCR analysis of TGF-α mRNA expression in ovariectomized female mice revealed that E2 increases TGF-α mRNA levels. These results indicate that the TGF-α produced primarily in the somatotrophs mediates the stimulatory effects of estrogen on the DNA replication of pituitary cells in a paracrine or autocrine manner.

INTRODUCTION

Many lines of evidence have shown that the development and function of pituitary cells are regulated by a paracrine or autocrine control with hormones, growth factors, and cytokines produced from the pituitary cells (Schwartz and Cherny, 1992; Denef, 1994; Takahashi, 1995; Renner et al., 1996; Ray and Melmed, 1997; Schwartz, 2000). Among the various growth factors synthesized in the anterior pituitary glands, members of the epidermal growth factor (EGF) family appear to be involved in the regulation of corticotrophs and mammotrophs (Childs et al., 1995; Fan and Childs, 1995; Oomizu et al., 2000). Transforming growth factor-α (TGF-α) belongs to the epidermal growth factor (EGF) family and shares the EGF-receptor (EGF-R) with EGF (Marquardt et al., 1983; Massague, 1990). TGF-α is produced in the pituitary glands of several species (Kudlow and Kobrin, 1984; Kobrin et al., 1987; Lazar and Blum, 1992). TGF-α in the pituitary gland has been localized to certain cell types, most notably mammotrophs and somatotrophs (Kobrin et al., 1987). In rat pituitary cells, TGF-α mRNA is expressed in somatotrophs, gonadotrophs, and mammotrophs (Fan and Childs, 1995). Immunoreactive EGF-Rs have been observed in subsets of all cell types of rat pituitary secretory cells, but only in some pituitary cells (Fan and Childs, 1995; Armstrong and Childs, 1997). Borgundvaag et al. (1992) have reported that chronic estrogen treatment induces a concurrent increase in the pituitary weight and TGF-α production, concluding that TGF-α is involved in estrogen-induced pituitary growth. We have directly demonstrated that TGF-α treatment stimulates DNA replication in mammotrophs and corticotrophs in vitro (Oomizu et al., 2000). However, in mouse pituitaries, the cell types of TGF α expressing cells are unknown, and the relationship between estrogen-induced DNA replication and TGF-α-induced replication is unclear. The aim of the present study was to identify the type of cells that express TGF-α mRNA and to clarify the mechanism of estrogen-induced DNA replication in the mouse pituitary. Expression of TGF-α mRNA was studied by Northern blot analysis. The types of cells expressing TGF-α mRNA were studied by in situ hybridization, and the effects of E2 on TGF-α synthesis were studied by reverse transcription-polymerase chain reaction (RTPCR).

MATERIALS AND METHODS

Animals

Adult male and female mice of the ICR strain (CLEA Japan Inc., Osaka, Japan) were housed in a temperature-controlled room with free access to the CE-7 commercial diet (CLEA Japan Inc.) and water. All animal care and experiments were carried out according to the Guidelines of Animal Experimentation, Faculty of Science, Okayama University, Japan.

Northern blot analysis

Total RNA from the anterior pituitaries of ovariectomized female mice was extracted using the method of Chomczynski and Sacchi (1987). Total cellular RNA was denatured by incubation at 65°C for 15 min with 1×MOPS, (0.02 M MOPS, 8 mM sodium acetate, 1 mM EDTA), 2.2 M formaldehyde and 50% (w/v) formamide. Total RNA (10 μg) was electrophoresed on a 1% agarose gel. The RNA was transferred to a nylon membrane (hybond-N+ Amersham, Arlington Hights, IL) by electroblotting (30 V, 16 hr). The transferred RNA was fixed with an UV lamp for 5 min. The membrane was prehybridized in 5×SSPE, 50% formamide, 5×Denhardt's solution, 10% dextran sulfate, and 1 mg/ml herring sperm DNA at 42°C for 2 hr. Hybridization was carried out at 42°C for 16 hr in hybridization buffer containing 50 ng [α-32P]dCTP-labelled probe. After the hybridization, the membrane was washed with 1×SSC and 0.1% SDS at 42°C for 20 min and 0.5×SSC and 0.1% SDS at 42°C for 20 min. Hybridized signals were detected by autoradiography.

In situ hybridization analysis of TGF-α mRNA-expressing cells

Pituitaries were quickly fixed overnight in 4% paraformalde-hyde in 0.01 M phosphate-buffered saline (PBS, pH 7.6) at 4°C. They were then embedded in paraffin and sectioned at a thickness of 5 μm thick. The sections were digested with 10 mg/ml proteinase K (Merck, Darmstad, Germany) at 37°C for 30 min. The reaction of proteinase K was blocked by 0.2% (w/v) glycine in 0.01 M PBS. The sections were fixed with 4% paraformaldehyde in 0.01 M PBS and were incubated in 0.25% acetic anhydride in 0.1M triethanolamine for 10 min at room temperature. The mouse TGF-α cDNA probe (pcrmTGFα-ST1), rat GH cDNA probe, and rat PRL cDNA probe were labelled with digoxigenin (DIG)-11-UTP at 37°C overnight (20 hr) by random primer using the DIG DNA labeling and detection kit (Boehringer Mannheim, Germany). pBR328 plasmids were labelled and used as a negative control for in situ hybridization.

The sections were hybridized at 42°C overnight in a solution of 5×SSPE, 1×Denhardt's solution, 10% (w/v) sodium dextran sulfate, 50% (v/v) deionized formamide, 120 μg/ml denatured herring sperm DNA, and 0.3 ng/μl DIG-labelled probe. The slides were washed in 1×SSC at room temperature for 10 min followed by 1×SSC and 0.5×SSC at 45°C for 15 min each. The final wash was carried out in 0.2 × SSC at room temperature for 1 min. Nonspecific binding was blocked by 0.5% (w/v) BSA in TN buffer (0.1 M Tris-HCl, 0.3 M NaCl, pH 7.5) for 30 min. Anti-DIG-alkaline phosphatase conjugate (1:1000) was applied to the slides and kept at room temperature for 1 hr. The slides were washed twice in 0.2% (v/v) Tween 20 TN buffer for 10 min. Nitro blue tetrazolium (NBT) and 5-bromo-4-chloro-3-indolyl phosphate (BCIP) were used as chromogens for hybridization detection. Color development was carried out for 20 hr at room temperature.

Preparation of cDNA Probes

A 502-bp mouse TGF-α cDNA clone (pcrmTGFα-ST1) was generated as follows. DNA fragments encoding a portion of mouse TGF-α was obtained from total RNA from ICR mice by RT-PCR. Oligonucleotide primers for TGF-α were designed based upon the mouse sequence and were synthesized by the Gibco BRL Custom Primers, Life Technologies Asia Pacific (Yokohama, Japan). The primer sequences and the location on the nucleotide sequences were as follows: TGF-α 5′ (AGCCAGAAGAAGCAAGCCATCACT, 367–390), TGF-α 3′ (CTCATTCTCGGTGTGGGTTAGCAA, 845–868). The cDNA fragments were subcloned into pGEM3zf(+). Clones were sequenced using fluorescent primers and an automated DNA sequencer, and were confirmed to be cDNAs encoding a portion of the mouse TGF-α.

The rat GH cDNA (790 bp) cloned to the Hind III site of the plasmid pBR322, and rat PRL cDNA (823 bp) cloned to the Pst 1 site of the plasmid pBR322 were kindly provided by Dr. J.A. Martial (University of Liege, Belgium).

Isolation of pituitary cells

Anterior pituitaries obtained from 2-month-old male mice were dissociated with 0.5% trypsin (0.5% w/v; DIFCO, Detroit, MI) as previously described (Oomizu et al., 1998). Cell viability was checked using the trypan blue exclusion test and was usually found to be more than 95%. The isolated pituitary cells were suspended in a 1:1 mixture of Dulbecco's modified Eagle's medium and Ham's F12 medium without phenol red (DMEM/F12 medium, Sigma Chemical Co., St. Louis, MO) containing fetal calf serum (FCS, 10%, v/v; Gibco BRL, Life Technologies, Inc., Rockville, MD). The cells were seeded on poly-L-lysine-(Sigma Chemical Co.) coated plastic coverslips (diameter 13 mm; Sumitomo, Tokyo, Japan) in 24-well tissue-culture plates (Becton Dickinson, Lincoln Park, NJ) at a cell density of 5 × 105 cells/ml per well. The culture was allowed to proceed in a humidified atmosphere of 5% CO2 and 95% air at 37°C.

Exposure to a TGF-α-specific antibody

After a 3-day culture in DMEM/F12 medium containing 10% FCS, the pituitary cells were cultured in serum-free DMEM/F12 medium supplemented with hydrocortisone (100 μg/l), triiodothyro-nine (400 ng/l), transferrin (10 mg/l), bovine glucagon (10 ng/ml), parathyroid hormone (200 ng/l), insulin (1 μg/l), and sodium selenite (5 μg/l) for another 3 days. Each treatment was performed on three plastic coverslips. An antibody specific for human TGF-α (1 μg IgG, Ab-3, Oncogene Science, Uniondale, NY) was added to the medium (500 μl) for 5 days with estradiol-17β (E2, 10−9 M). The TGF-α antibody treated with excess human TGF-α (1 ng) for 30 min at room temperature was also added to the medium with E2. The medium containing the antibody and E2 was changed daily. After a 5-day exposure to the antibody specific to TGF-α, a 5-bromo-2′-deoxyuridine (BrdU) solution of the cell proliferation kit (Amersham) was added to the culture media (3 mg/ml) for 12 hr to assess DNA-replicating cells. The cultured cells were fixed in Bouin's solution for 30 min at room temperature, and immunocytochemical detection was performed as described previously (Oomizu et al., 2000).

Quantification of the immunolabelled cells

Cells were observed under a light microscope at ×600 magnification. The fields were scanned across the coverslip to avoid overlap. In each field, immunopositive and immunonegative cells were counted, and more than 1000 cells were observed from each coverslip. The percentages of BrdU-labelled cells indicate those of cells that had a densely labelled nucleus in relation to the total cells. Each group consisted of three coverslips.

Ovariectomy and estrogen treatment

Two-month-old female mice were ovariectomized under ether anesthesia. Seven days after the ovariectomy a single subcutaneous injection of E2 (Sigma Chemical Co.) was given at a dose of 250 ng in 0.05 ml of sesame oil. Ovariectomized female mice treated with sesame oil only served as controls. Pituitaries were obtained 48 hr after the E2 injection.

cDNA synthesis and PCR amplification

Total RNA (2 μg) in a final volume of 20 μl was subjected to reverse transcription using Superscript II Reverse Transcriptase (Gibco-BRL) with random primers according to the manufacturer's instructions. Each PCR was performed using primer pairs specific for TGF-α, as described, and primer pairs specific for β-actin, as based on a previous report (Matsuda and Mori, 1997). The size of the resulting DNA fragment following PCR amplification was 502 base pairs (bp) for TGF-α and 469 bp for β-actin. These primers generate PCR products of 502 bp for TGF-α and 469 bp for β-actin respectively. These primers were synthesized by Gibco BRL Custom Primers, Life Technologies Asia Pacific (Yokohama, Japan). PCR was performed using Takara Taq (Takara, Otsu, Japan) and a thermal cycler (Gene Amp PCR System 9700, Applied Biosystems, Branchburg, NJ). The conditions for PCR were as follows: after activation of DNA polymerase by a 20-sec incubation at 95°C, 40 cycles (for TGF-α cDNA) and 25 cycles (for β-actin cDNA) of reactions, including denaturation for 30 sec at 95°C and extension for 1 min at 60°C, followed by an additional extension for 10 min at 60°C.

A 10-μl aliquot of each reaction was electrophoresed on 2% agarose gel, stained with ethidium bromide, and photographed under ultraviolet rays.

Statistics

Data are presented as the mean±S.E.M and were analyzed by analysis of variance followed by Duncan's multiple range tests.

RESULTS

Detection of TGF-α mRNA in the anterior mouse pituitary by Northern blot analysis

Northern blot analysis using the mouse TGF-α cDNA probe revealed that a single band of TGF-α mRNA (4.7 kb) was expressed in the mouse anterior pituitary gland (Fig. 1).

Fig. 1

Northern blot analysis of pituitary TGF-α mRNA. Total RNA (10 μg) obtained from adult female mice was electrophoresed on a 1% agarose gel and then transferred to a nylon membrane. The membrane was hybridized with 32P-dCTP-labelled mouse TGF-α cDNA probes. The relative positions of the 28S and 18S ribosomal RNAs are shown.

i0289-0003-20-1-83-f01.gif

In situ hybridization analysis of TGF-α mRNA-expressing cells

TGF-α mRNA-expressing cells were found to be evenly distributed throughout the anterior pituitary gland, but not the intermediate or posterior lobes (Fig. 2A). TGF-α mRNA-expressing cells were round, oval, and medium-sized (Fig. 2B). In control experiments for in situ hybridization, no signal was detected when DIG-labelled pBR328 probes were used as controls (Fig. 2C). In adult male pituitaries, TGF-α mRNA-expressing cells accounted for 65% (±2.1, n=3) of the total pituitary cells, and for 55% (±1.7, n=3) in adult female pituitaries.

Fig. 2

TGF-α mRNA expression in the male mouse pituitary was analyzed by in situ hybridization. A: TGF-α mRNA-expressing cells were evenly distributed throughout the anterior pituitary. TGF-α mRNA-expressing cells were observed in a subpopulation of secre-tory cells in the anterior lobe (a), but not in the intermediate (i) or posterior lobes (p). Bar=50 μm B: TGF-α mRNA-expressing cells in the anterior pituitary (arrow) were round, oval and medium sized. Bar=10 μm C: in situ hybridization using pBR328 DIG-labelled probes detected no signals in the anterior pituitary cells. Bar=10 μm

i0289-0003-20-1-83-f02.jpg

Characterization of TGF-α mRNA-expressing cells

For the determination of the cell types of TGF-α mRNA-expressing cells, serial sections were studied by non radio-isotopic in situ hybridization using cDNA probes for TGF-α mRNA (Fig. 3A and 3C), GH mRNA (Fig. 3B) and PRL mRNA (Fig. 3D). Most of the GH mRNA-expressing cells contained TGF-α mRNA (79–83%), whereas only a small population of PRL mRNA-expressing cells contained TGF-α mRNA (1–3%).

Fig. 3

Determination of TGF-α mRNA-expressing cell types by in situ hybridization using serial sections of the anterior pituitary glands from adult male (A and B), and female (C and D) mice. in situ hybridization was carried out using cDNA probes for TGF-α mRNA (A and C), GH mRNA (B) and PRL mRNA (D). Paired photographs of A and B, and those of C and D are adjacent sections obtained from the serial sections of mouse pituitary glands (5 μm thick), respectively. The cells (#1, #2, #3 and #4) expressed both TGF-α mRNA and GH mRNA. The cells (#5) expressed both TGF-α mRNA and PRL mRNA, while the cells (#6 and #7) expressed PRL mRNA, but not TGF-α mRNA. Bar=20 μm

i0289-0003-20-1-83-f03.jpg

Effects of anti-TGF-α antibody treatment on DNA replication in pituitary cells

E2 treatment for 5 days significantly increased the percentage of BrdU-labelled cells (p<0.01). Treatment of pituitary cells with a combination of E2 and anti-TGF-α anti-bodies did not increase the number of BrdU-labelled cells (Fig. 4). The TGF-α antibody with excess TGF-α did not affect E2-induced increase in the percentage of BrdU-labelled cells.

Fig. 4

Effect of E2 and anti-TGF-α antibody on the number of BrdU-labelled pituitary cells. After a 3-day culture in serum-free DME/F12 medium, an antibody specific for human TGF-α (1 μg IgG1) was added to the medium (500 μl) for 5 days with estradiol-17β (E2, 10−9 M). After the exposure to E2 and the antibody, BrdU solution was added to the culture media for 12 hr to assess DNA synthesizing cells. E2 treatment increased the number of BrdU-labelled cells compared with the control (*p<0.01). Treatment with a combination of anti-TGF-α antibody and E2 decreased the number of BrdU-labelled cells compared with E2 treatment (#p<0.01).

i0289-0003-20-1-83-f04.gif

RT-PCR analysis of TGF-α mRNA levels

To determine the effects of E2 on TGF-α gene expression, the relative TGF-α mRNA content was measured using semiquantitative RT-PCR. The technical validation of this assay is depicted in Fig. 5A,B. Various amounts of RT products (in volume, 0.5, 1, 1.5, 2 μl) for TGF-α and β-actin cDNAs were amplified to ensure linearity for the PCR-amplification (Fig. 5A). The PCR products for TGF-α mRNA and β-actin mRNA increased in accordance with the increase in RT products (templates). TGF-α mRNA levels were determined using 1 μl of RT product, and were normalized according to the intensity of the co-amplified β-actin cDNA value. PCR analysis under this condition revealed an increase in TGF-α mRNA levels in response to E2 treatment compared with the control treatment (Fig. 5C).

Fig. 5

Analyses of TGF-α and β-actin mRNAs amplified by RT-PCR. Effect of E2 treatment on the amount of TGF-α mRNA was studied in the pituitary cells of ovariectomized mice. E2 was subcutaneously injected to the ovariectomized mice at a dose of 250 ng/mouse. Pituitaries were obtained after 48 hr of the injection. RNA samples were collected and subjected to RT-PCR. A: The analysis of the linearity of TGF-α and β-actin cDNAs in relation to the amount of RT products. PCR amplification was carried out with various amounts of (0.5–2 μl) of the RT products (for TGF-α and β-actin) from controls and E2-treated mice. Each PCR product was electrophoresed on a 2% agarose gel, stained with ethidium bromide, and photographed under UV irradiation. The number above the gel pictures depict the amount of RT products (μl). The band intensities of TGF-α and β-actin cDNAs were increased with increasing amount of RT products. B: The analysis of quantiataive changes in the bands depicted in A. The relative amounts of TGF-α mRNA were normalized according to the β-actin mRNA levels in each sample. C: The summary of the change of TGF-α mRNA levels induced by E2 treatment. The TGF-α mRNA levels were normalized as performed in B, and the relative values were expressed by regarding the control value as 1.0. Each column represents the mean (±S.E.M) of three independent experiments. For the semiquantitative analysis of the relative amounts of TGF-α mRNA the band intensities of 1 μl of RT product were used. *p<0.01, significantly different from the control.

i0289-0003-20-1-83-f05.gif

DISCUSSION

It is well known that estrogen stimulates the mammotroph proliferation (Lloyd et al., 1975; Takahashi and Kawashima, 1987). We have recently shown that estrogen-induced growth is inhibited by treatment with RG-13022, a specific inhibitor for EGF receptors in adult mouse pituitaries. TGF-α treatment stimulates DNA replication of pituitary cells (Oomizu et al., 2000). Accordingly, these results suggest that the estrogen-induced DNA replication of pituitary cells is mediated by TGF-α through the EGF-receptor signaling pathway. However, as far as we know, the cell types of TGF-α-expressing cells have not previously been studied in mouse pituitaries, and the mechanism of TGF-α leading to DNA replication within the pituitary gland has remained unclear. We have demonstrated in the present study that TGF-α mRNA is expressed only in the anterior lobe, but not the intermediate and posterior lobes. Treatment with an antibody specific for TGF-α appears to reduce estrogen-induced DNA replication, clearly indicating that TGF-α acts on mammotrophs as paracrine regulator for pituitary functions through EGF receptors.

We found a 4.7-kb band for TGF-α mRNA in the anterior pituitary by Northern blot analysis using mouse TGF-α cDNA. TGF-α mRNA of similar size has previously been detected in other mouse tissues (Tamada et al., 1991). In the present study, TGF-α was detected primarily in somatotrophs and in some of the mammotrophs in the mouse pituitaries. We did not study the other types of pituitary cells for TGF-α mRNA expression. TGF-α mRNA-expressing cells made up 55–65% of anterior pituitary cells in the present study, and most of the somatotrophs expressed TGF-α mRNA. It is well known that somatotrophs account for almost half of the total anterior pituitary cells (Sasaki and Iwama, 1988). Therefore, most TGF-α mRNA-expressing cells seem to be somatotrophs in mouse pituitaries. On the other hand, Kobrin et al. (1987) has localized immunoreactive TGF-α in mammotrophs and possibly in somatotrophs in the bovine anterior pituitary. In human pituitary TGF-α is localized in somatotrophs (Finley et al., 1994). Fan and Childs (1995) have reported based on in situ hybridization results that somatotrophs, gonadotrophs, and mammotrophs express TGF-α mRNA in the rat pituitaries. The discrepancy in the cell types of TGF-α-mRNA expressing cells among these reports may in part be due to the difference in the animal species examined. In rat and mouse pituitaries, somatotrophs and mammotrophs are closely located and are distributed evenly throughout the anterior lobes of the pituitary glands. Based on these findings, it is very likely that the TGF-α produced in somatotrophs acts on adjacent mammotrophs in a paracrine manner to stimulate DNA replication of mammotrophs.

Pituitary TGF-α expression is regulated under the influence of hormones, neurotransmitters, and other growth factors (Kobrin et al., 1987; Borgundvaag et al., 1992). Acute estrogen treatment increases TGF-α mRNA levels in the mouse anterior pituitary. Similarly, chronic estrogen treatment stimulates TGF-α gene expression in rat pituitaries (Borgundvaag et al., 1992). Furthermore, blockage of TGF-α synthesis by treatment with antisense oligodeoxynucleotide for TGF-α mRNA decreases estrogen-induced DNA replication in mammotrophs (Oomizu et al., 2000). Altogether, these findings have led us to hypothesize that estrogen-induced TGF-α expression is involved in the DNA replication in pituitary cells.

Cell proliferation in the females has been found to fluctuate during the estrous cycle, with the highest activity being at estrus (Takahashi et al., 1984; Oishi et al., 1993). This high proliferation of mammotrophs depends upon ovarian estrogen, since ovariectomy decreases the high levels of mitotic activity observed at estrus (Takahashi et al., 1984). As TGF-α expression is stimulated by estrogen, the high proliferation rate of mammotrophs at estrus may be produced by the enhanced TGF-α release induced by high estrogen titers during a proestrous day. Accordingly, it is necessary to study a change in TGF-α gene expression during the estrous cycle in female mice.

We have recently reported detecting EGF-R mRNA in the mouse pituitary (Honda et al., 2000). Fan and Childs (1995) have also found that all subsets of rat pituitary cells express EGF-Rs. EGF-R expression changes with various conditions such as stress and the estrous cycle (Fan and Childs, 1995; Armstrong and Childs, 1997; Armstrong and Childs, 1997). Moreover, estrogen stimulates EGF-R levels in the rat uterus (Mukku and Stancel, 1985). Similarly, estrogen treatment with E2 increases both EGF-R mRNA (Oomizu et al., 2000) and TGF-α mRNA levels in the mouse pituitary. Thus, estrogen appears to stimulate pituitary growth at the level of both TGF-α and EGF receptor production.

Roh et al. (2001) has shown that EGF-R signaling is required for the differentiation of pituitary cells only in early pituitary organogenesis. The overexpression of human TGF-α induced in transgenic mice accelerates the development of pituitary mammotrophic adenoma (McAndrew et al., 1995). In pituitary tumor cells, TGF-α affects cell proliferation in either a stimulatory or inhibitory manner (Ramsdell, 1991; Finley and Ramsdell, 1994). Thus, TGF-α is involved in the growth of normal and tumor pituitary cells. However, it remains to be determined whether factors such as age and sex affect the TGF-α-induced proliferation of pituitary cells in mice.

In conclusion, we have shown in the present study that estrogen acts on somatotrophs to stimulate TGF-α synthesis, and that this TGF-α acts on pituitary cells to stimulate DNA replication. It is known that TGF-α stimulates the proliferation of mammotrophs (Oomizu et al., 2000). Therefore, these findings suggest that estrogen induced growth of mammotrophs is governed by at least the presence of TGF-α-producing somatotrophs.

Acknowledgments

This study was supported in part by Grant-in-Aid for Scientific Research from Japan Society for the Promotion of Science to S.T.

REFERENCES

1.

J. Armstrong and G. V. Childs . 1997. Changes in expression of epidermal growth factor receptors by anterior pituitary cells during the estrous cycle: cyclic expression by gonadotropes. Endocrinology 138:1903–1908. Google Scholar

2.

J. Armstrong and G. V. Childs . 1997. Differential expression of c-fos in vitro by all anterior pituitary cell types during the estrous cycle: enhanced expression by luteinizing hormone but not by follicle-stimulating hormone cells. J Histochem Cytochem 45:785–794. Google Scholar

3.

B. Borgundvaag, J. E. Kudlow, S. G. Mueller, and S. R. George . 1992. Dopamine receptor activation inhibits estrogen-stimulated transforming growth factor-alpha gene expression and growth in anterior pituitary, but not in uterus. Endocrinology 130:3453–3458. Google Scholar

4.

G. V. Childs, D. Rougeau, and G. Unabia . 1995. Corticotropin-releasing hormone and epidermal growth factor: mitogens for anterior pituitary corticotropes. Endocrinology 136:1595–1602. Google Scholar

5.

P. Chomczynski and N. Sacchi . 1987. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162:156–159. Google Scholar

6.

C. Denef 1994. Paracrine mechanisms in the pituitary. In “The Pituitary Gland”. Ed by H. Imura Raven Press Ltd. New York. pp. 351–378. Google Scholar

7.

X. Fan and G. V. Childs . 1995. Epidermal growth factor and transforming growth factor-alpha messenger ribonucleic acids and their receptors in the rat anterior pituitary: localization and regulation. Endocrinology 136:2284–2293. Google Scholar

8.

E. L. Finley, J. S. King, and J. S. Ramsdell . 1994. Human pituitary somatotropes express transforming growth factor-alpha and its receptor. J Endocrinol 141:547–554. Google Scholar

9.

E. L. Finley and J. S. Ramsdell . 1994. A transforming growth factor-alpha pathway is expressed in GH4C1 rat pituitary tumors and appears necessary for tumor formation. Endocrinology 135:416–422. Google Scholar

10.

J. Honda, S. Oomizu, Y. Kiuchi, N. Komatsu, S. Takeuchi, and S. Takahashi . 2000. Identification of epidermal growth factor mRNA-expressing cells in the mouse anterior pituitary. Neuroendocrinology 71:155–162. Google Scholar

11.

M. S. Kobrin, S. L. Asa, J. Samsoondar, and J. E. Kudlow . 1987. Alpha-transforming growth factor in the bovine anterior pituitary gland: secretion by dispersed cells and immunohistochemical localization. Endocrinology 121:1412–1416. Google Scholar

12.

J. E. Kudlow and M. S. Kobrin . 1984. Secretion of epidermal growth factor-like mitogens by cultured cells from bovine anterior pituitary glands. Endocrinology 115:911–917. Google Scholar

13.

L. M. Lazar and M. Blum . 1992. Regional distribution and developmental expression of epidermal growth factor and transforming growth factor-alpha mRNA in mouse brain by a quantitative nuclease protection assay. J Neurosci 12:1688–1697. Google Scholar

14.

H. M. Lloyd, J. D. Meares, and J. Jacobi . 1975. Effects of oestrogen and bromocryptine on in vivo secretion and mitosis in prolactin cells. Nature 225:497–498. Google Scholar

15.

H. Marquardt, M. W. Hunkapiller, L. E. Hood, D. R. Twardzik, J. E. De Larco, J. R. Stephenson, and G. J. Todaro . 1983. Transforming growth factors produced by retrovirus-transformed rodent fibroblasts and human melanoma cells: amino acid sequence homology with epidermal growth factor. Proc Natl Acad Sci USA 80:4684–4688. Google Scholar

16.

J. Massague 1990. Transforming growth factor-α: A model for membrane-anchored growth factors. J Biol Chem 265:21393–21396. Google Scholar

17.

M. Matsuda and T. Mori . 1997. Effect of hormones on expression of prolactin receptor messenger ribonucleic acids in pancreatic islets of adult female mice in vitro. Zool Sci 14:159–165. Google Scholar

18.

J. McAndrew, A. J. Paterson, S. L. Asa, K. J. McCarthy, and J. E. Kudlow . 1995. Targeting of transforming growth factor-alpha expression to pituitary lactotrophs in transgenic mice results in selective lactotroph proliferation and adenomas. Endocrinology 136:4479–4488. Google Scholar

19.

V. R. Mukku and G. M. Stancel . 1985. Receptors for epidermal growth factor in the rat uterus. Endocrinology 117:149–154. Google Scholar

20.

Y. Oishi, M. Okuda, H. Takahashi, T. Fujii, and S. Morii . 1993. Cellular proliferation in the anterior pituitary gland of normal adult rats: influence of sex, estrous cycle, and circadian change. Anat Rec 235:111–120. Google Scholar

21.

S. Oomizu, J. Honda, S. Takeuchi, T. Kakeya, T. Masui, and S. Takahashi . 2000. Transforming growth factor-α stimulates proliferation of mammotrophs and corticotrophs in the mouse pituitary. J Endocrinol 165:493–501. Google Scholar

22.

S. Oomizu, S. Takeuchi, and S. Takahashi . 1998. Stimulatory effect of insulin-like growth factor I on proliferation of mouse pituitary cells in serum-free culture. J Endocrinol 157:53–62. Google Scholar

23.

J. S. Ramsdell 1991. Transforming growth factor-alpha and -beta are potent and effective inhibitors of GH4 pituitary tumor cell proliferation. Endocrinology 128:1981–1990. Google Scholar

24.

D. Ray and S. Melmed . 1997. Pituitary cytokine and growth factor expression and action. Endocr Rev 18:206–228. Google Scholar

25.

U. Renner, U. Pagotto, E. Arzt, and G. K. Stalla . 1996. Autocrine and paracrine roles of polypeptide growth factors, cytokines and vasogenic substances in normal and tumors pituitary function and growth: a review. Eur J Endocrinol 135:515–532. Google Scholar

26.

M. Roh, A. J. Paterson, S. L. Asa, E. Chin, and J. E. Kudlow . 2001. Stage-sensitive blockade of pituitary somatomammotrope development by targeted expression of a dominant negative epidermal growth factor receptor in transgenic mice. Mol Endocrinol 15:600–613. Google Scholar

27.

F. Sasaki and Y. Iwama . 1988. Sex difference in prolactin and growth hormone cells in mouse adenohypophysis: stereological, morphometric, and immunohistochemical studies by light and electron microscopy. Endocrinology 123:905–912. Google Scholar

28.

J. Schwartz 2000. Intercellular communication in the anterior pituitary. Endocr Rev 21:488–513. Google Scholar

29.

J. Schwartz and R. Cherny . 1992. Intercellular communication within the anterior pituitary influencing the secretion of hypophysial hormones. Endocr Rev 13:453–475. Google Scholar

30.

S. Takahashi 1995. Development and heterogeneity of prolactin cells. Int Rev Cytol 157:33–98. Google Scholar

31.

S. Takahashi and S. Kawashima . 1987. Proliferation of prolactin cells in the rat: effects of estrogen and bromocryptine. Zool Sci 4:855–860. Google Scholar

32.

S. Takahashi, K. Okazaki, and S. Kawashima . 1984. Mitotic activity of prolactin cells in the pituitary glands of male and female rats of different ages. Cell Tissue Res 235:497–502. Google Scholar

33.

H. Tamada, S. K. Das, G. K. Andrews, and S. K. Dey . 1991. Cell-type-specific expression of transforming growth factor-α in the mouse uterus during the peri-implantation period. Biol Reprod 45:365–372. Google Scholar
Seema Sharma, Souichi Oomizu, Tomoshi Kakeya, Tohru Masui, Sakae Takeuchi, and Sumio Takahashi "Gene Expression and the Physiological Role of Transforming Growth Factor-α in the Mouse Pituitary," Zoological Science 20(1), 83-89, (1 January 2003). https://doi.org/10.2108/zsj.20.83
Received: 9 August 2002; Accepted: 1 October 2002; Published: 1 January 2003
JOURNAL ARTICLE
7 PAGES


Share
SHARE
KEYWORDS
estrogen
mammotroph
pituitary
somatotroph
transforming growth factor-α (TGF-α )
RIGHTS & PERMISSIONS
Get copyright permission
Back to Top